ID: 956321411

View in Genome Browser
Species Human (GRCh38)
Location 3:68000758-68000780
Sequence CCATTCAACTACCCTCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956321411_956321419 30 Left 956321411 3:68000758-68000780 CCTGGATGAGGGTAGTTGAATGG No data
Right 956321419 3:68000811-68000833 AAACAGGAAGTAGAATTAATAGG No data
956321411_956321417 4 Left 956321411 3:68000758-68000780 CCTGGATGAGGGTAGTTGAATGG No data
Right 956321417 3:68000785-68000807 GGAGAAAGTGGATGGATTTGAGG No data
956321411_956321415 -8 Left 956321411 3:68000758-68000780 CCTGGATGAGGGTAGTTGAATGG No data
Right 956321415 3:68000773-68000795 TTGAATGGAGAGGGAGAAAGTGG No data
956321411_956321416 -4 Left 956321411 3:68000758-68000780 CCTGGATGAGGGTAGTTGAATGG No data
Right 956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG No data
956321411_956321418 14 Left 956321411 3:68000758-68000780 CCTGGATGAGGGTAGTTGAATGG No data
Right 956321418 3:68000795-68000817 GATGGATTTGAGGCATAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956321411 Original CRISPR CCATTCAACTACCCTCATCC AGG (reversed) Intergenic
No off target data available for this crispr