ID: 956321416

View in Genome Browser
Species Human (GRCh38)
Location 3:68000777-68000799
Sequence ATGGAGAGGGAGAAAGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956321411_956321416 -4 Left 956321411 3:68000758-68000780 CCTGGATGAGGGTAGTTGAATGG No data
Right 956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956321416 Original CRISPR ATGGAGAGGGAGAAAGTGGA TGG Intergenic
No off target data available for this crispr