ID: 956321629

View in Genome Browser
Species Human (GRCh38)
Location 3:68004003-68004025
Sequence CAAAATACTGATAGTATTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 288}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956321629 Original CRISPR CAAAATACTGATAGTATTAG TGG (reversed) Intergenic
902045763 1:13523046-13523068 CAAAATAATAATAATAATAGTGG + Intergenic
902783697 1:18719917-18719939 CCAAATACTAATAGGAGTAGAGG - Intronic
906895951 1:49772266-49772288 CAAAATACAAATAGTATGAGGGG - Intronic
907168765 1:52440899-52440921 CAAAATAATTATATTCTTAGTGG - Intronic
909039698 1:70634453-70634475 CAAAATAATGATAGATGTAGTGG - Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909857592 1:80558409-80558431 CAAAAAACTGATTGTTCTAGTGG - Intergenic
910223950 1:84917275-84917297 CAGAATACAGATTTTATTAGTGG + Intergenic
911956048 1:104236441-104236463 CCAATTACTGATGGTATTGGTGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
914845017 1:151278471-151278493 CAAAATAATAATAATAATAGGGG - Intergenic
915080808 1:153350386-153350408 ATAAATAATGATAGTATTAAAGG - Intergenic
917023907 1:170620587-170620609 CAAATTACTGTTACTATTATGGG + Intergenic
917876591 1:179292226-179292248 AAAAATATTGATAGTATTCTTGG - Intergenic
918787260 1:188777888-188777910 CAAAATATTGAAAGTATTAGTGG + Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
921532622 1:216304170-216304192 CTAAATTCAGATATTATTAGCGG - Intronic
922782136 1:228261163-228261185 CAAAATAATGATAATAATAATGG - Intronic
923583334 1:235240103-235240125 CAAAATCTTGATAATCTTAGAGG - Intronic
1062958634 10:1556900-1556922 AAAAATAGTGATAGGAATAGAGG - Intronic
1062988987 10:1797953-1797975 CATATTACTAATAGTACTAGTGG + Intergenic
1063423316 10:5931586-5931608 CAAAATAATGCCAGTATTAATGG + Intronic
1066780345 10:38939224-38939246 GAAAATGCTGTTAGTATGAGTGG + Intergenic
1070130943 10:73655078-73655100 CAAAGTAATAATAGTAGTAGTGG + Intronic
1072296103 10:94010847-94010869 CAAAATACTGATAGAAATATGGG - Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1072899326 10:99393404-99393426 TTAAATACTGACAGTTTTAGGGG - Exonic
1074409003 10:113208050-113208072 AAATATGCTGATAGTATTATGGG - Intergenic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080997171 11:37618383-37618405 CAAAATACTGATAGTAACATGGG + Intergenic
1081004150 11:37712937-37712959 TAAAATACTGATTCTAGTAGTGG - Intergenic
1081122757 11:39286521-39286543 CAAAATACTGATAGCGATATGGG - Intergenic
1082625933 11:55485505-55485527 CAAATTACTGATTGAATTAAGGG + Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1086862023 11:91935429-91935451 AAAAATACTGATAGGAATAGGGG - Intergenic
1087388149 11:97499716-97499738 GAAAATAATGATGGTTTTAGGGG - Intergenic
1087392399 11:97554258-97554280 CAAAATATTGTTAGTATTATTGG - Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088443421 11:109897060-109897082 AAAATTACTGAAAGTATTAAAGG + Intergenic
1089232012 11:116986400-116986422 AATAATACTAACAGTATTAGTGG - Intronic
1090506603 11:127321514-127321536 TAAAATGCTGATAGTGTTATGGG - Intergenic
1092289710 12:7152126-7152148 CAGAATACTCATATTATCAGTGG - Intronic
1092836822 12:12497996-12498018 CAAAACACTAATAATATTAGTGG + Intronic
1094090937 12:26648579-26648601 AAAAATACTTACAGTATGAGAGG + Intronic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1094685218 12:32705612-32705634 CAAAATACAACTAGAATTAGAGG - Intronic
1095104415 12:38214474-38214496 CAAAATACTACTTATATTAGGGG - Intergenic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095772097 12:45971396-45971418 CAAAATACTGACAGAATGAATGG + Intronic
1096960340 12:55570708-55570730 CAAAATACTGATAGCAATATGGG - Intergenic
1097485447 12:60192539-60192561 CAAAATTCTAATAGAAATAGTGG - Intergenic
1097852263 12:64423797-64423819 TAAAATATTGATAATATTATTGG + Intronic
1098608074 12:72419189-72419211 CTAAATTCTGATAGTATAATTGG + Intronic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1100656654 12:96653895-96653917 CAAATTACTCATATTAGTAGTGG + Intronic
1102839334 12:116101242-116101264 CAAAGAACTGATAGTTTTATTGG - Intronic
1103373897 12:120440093-120440115 CAAAATGGTGGCAGTATTAGGGG - Intronic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1107027239 13:35814866-35814888 CAAAATACTGACAGTCTTTATGG - Intronic
1107101787 13:36600940-36600962 CAAAATACTCATGGTTTGAGTGG - Intergenic
1107141865 13:37007295-37007317 CAAAATAGTGTTAATATTGGTGG + Intronic
1108301226 13:49078337-49078359 TAAGATACTGTTAGTATTACAGG - Intronic
1108833181 13:54505092-54505114 CAAATTACTGATATTATTCTGGG - Intergenic
1109727922 13:66369334-66369356 CAAAATTGTGTTAGTATAAGTGG - Intronic
1110046262 13:70835851-70835873 CAAAAGAATGATCGTATTAAAGG + Intergenic
1111099318 13:83561041-83561063 CAAAATAATAATAATATTAAAGG + Intergenic
1111317281 13:86579694-86579716 AAAAATACTGCTATTTTTAGAGG - Intergenic
1112861455 13:103833063-103833085 CAAAATACTGATACTGATATTGG + Intergenic
1112998922 13:105609079-105609101 CATAATATTGATTGTATTAGAGG - Intergenic
1113204554 13:107901153-107901175 CAAAGTATTGATTGTATTTGTGG - Intergenic
1114040000 14:18668931-18668953 AGAAATAATGATAGTAATAGTGG + Intergenic
1114045033 14:18867454-18867476 AGAAATAATGATAGTAATAGTGG + Intergenic
1114119177 14:19652014-19652036 AGAAATAATGATAGTAATAGTGG - Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1115099531 14:29681905-29681927 CAGCATACTGTTAGTATTATTGG - Intronic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116381945 14:44280404-44280426 GAAAATACAGAGAGTAGTAGGGG - Intergenic
1117142910 14:52808051-52808073 CAAGAAACTGGCAGTATTAGTGG + Intergenic
1117369969 14:55068735-55068757 CAAAATACTGATTATTTTATTGG - Exonic
1119184289 14:72628484-72628506 CAAAATAGTGATATTCTTATTGG - Intronic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1121372130 14:93369164-93369186 CAAAAAACTGGTAGTAGTAAAGG + Intronic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1124504012 15:30256338-30256360 CAAGACACTGTTAGTATTGGCGG + Intergenic
1124739542 15:32282308-32282330 CAAGACACTGTTAGTATTGGCGG - Intergenic
1125151612 15:36538774-36538796 CAAAAAAGTGGTGGTATTAGAGG - Intergenic
1125361471 15:38868753-38868775 CACAATACTGATTATATTACTGG + Intergenic
1125398113 15:39271642-39271664 CAAGATGCTGTTAGTATGAGTGG + Intergenic
1126525690 15:49651854-49651876 GAAAAAAGTGATATTATTAGTGG - Exonic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1128193008 15:65722110-65722132 GAAAATGCTGATGGTATCAGTGG - Intronic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1133644114 16:7747023-7747045 CACACTAATGTTAGTATTAGCGG + Intergenic
1137227727 16:46531179-46531201 CAGAATATTGAAAGTATAAGAGG + Intergenic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1140582162 16:76243828-76243850 GAAGATACTGATAGTTATAGAGG - Intergenic
1203145973 16_KI270728v1_random:1799706-1799728 CAAAATACTTATTGTATTGTTGG + Intergenic
1142751128 17:1988439-1988461 CAAAATACTGAACATATTCGTGG - Intronic
1142789466 17:2252428-2252450 CAAAATACTGAACATATTCGTGG - Intronic
1143699571 17:8648172-8648194 GAAAATAGTGCTATTATTAGTGG - Intergenic
1148247210 17:46041009-46041031 CAAAATACTGATAGAAATACGGG + Intronic
1149129763 17:53284170-53284192 AACAAAACTGATATTATTAGAGG - Intergenic
1153872251 18:9332253-9332275 AAAGATAATGATGGTATTAGTGG - Intergenic
1154044223 18:10889206-10889228 GAAAAAACTGATAGTACTTGGGG - Intronic
1154344144 18:13528309-13528331 CAAAATAATAATAGTAATAATGG - Intronic
1155895942 18:31325878-31325900 TAAAATGGAGATAGTATTAGTGG + Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156736683 18:40268277-40268299 AGAAATACTGATATTATTAAGGG + Intergenic
1158999884 18:62963823-62963845 CAAAACAGAGATAGTATTAAAGG + Intronic
1166208090 19:41286250-41286272 CAATATACTGAAAATATTTGTGG - Intronic
1166570257 19:43791282-43791304 CAAAAAACTAAAAATATTAGTGG - Intergenic
925935224 2:8751234-8751256 GAAAATCCTGTTAGTATTTGTGG - Intronic
927140507 2:20127171-20127193 CAAAATTCTGATGGTGTTAATGG + Intergenic
928771445 2:34706715-34706737 CACAATAATGATACTATTTGAGG + Intergenic
928847760 2:35699012-35699034 CAATGTACTGTTACTATTAGTGG + Intergenic
929959797 2:46487937-46487959 TAGAATTCTGATAGTATGAGTGG + Intergenic
930691177 2:54366734-54366756 AAAAATACTGAAAGTAATAATGG + Intronic
930833528 2:55770892-55770914 CAAAATACTTGTTTTATTAGAGG + Intergenic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930973963 2:57431703-57431725 CAAGACATTGATAGTAGTAGTGG - Intergenic
932783689 2:74580792-74580814 CAGAATACTGGTAGTGGTAGTGG - Intronic
933443289 2:82342736-82342758 GAAAGTACTCATAGTATTAATGG - Intergenic
935591481 2:104849853-104849875 CAAAATAAAGCTAGTTTTAGTGG + Intergenic
935996449 2:108779322-108779344 AAAAATACTAAAAGAATTAGCGG - Intronic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937790042 2:125950079-125950101 CAAAATACAGATAAAATTTGAGG + Intergenic
938270552 2:129966663-129966685 AGAAATAATGATAGTAATAGTGG - Intergenic
939117321 2:138075347-138075369 CAAAAAACTAATAGTATTTAAGG - Intergenic
940193405 2:151066354-151066376 CAAATTACTAATATTAATAGTGG - Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940549485 2:155134932-155134954 CAAAAGACTGATAGAATTCATGG + Intergenic
941501841 2:166289154-166289176 CAAAATAGTTTTAGGATTAGAGG + Intronic
942003134 2:171670432-171670454 AAAAGTACAGATATTATTAGTGG - Intergenic
943139175 2:183957643-183957665 CAAACTACTCCAAGTATTAGTGG + Intergenic
943296644 2:186148667-186148689 CAAAACACTGATAGTAATCCAGG - Intergenic
943359704 2:186902432-186902454 CAAAATAATGATAGCATTTTAGG - Intergenic
944307639 2:198196033-198196055 CAAAATAGTAATTATATTAGAGG - Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
948429038 2:237907099-237907121 CAACATCTTGAAAGTATTAGAGG - Intronic
1170308032 20:14961243-14961265 AGAAATACTGAGAATATTAGAGG + Intronic
1171369897 20:24655344-24655366 CAAAATAATGACCATATTAGGGG + Intronic
1176677691 21:9795040-9795062 AAAAAAACTGAGAGCATTAGTGG - Intergenic
1177324309 21:19563917-19563939 CAGAATACTGATACTTTTTGAGG + Intergenic
1177485862 21:21755425-21755447 CAAAATACTCAGAGCAGTAGAGG - Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1178166312 21:29982060-29982082 CTCAGTAATGATAGTATTAGGGG - Intergenic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
1180463564 22:15590068-15590090 AGAAATAATGATAGTAATAGTGG + Intergenic
949736998 3:7184917-7184939 GAAAATATTAATATTATTAGTGG + Intronic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951262307 3:20524252-20524274 CATAATAATGATATTATAAGTGG - Intergenic
952465919 3:33585819-33585841 AAAAATAGTGATAGAATTACCGG - Intronic
953144607 3:40262870-40262892 CAAAATAAATACAGTATTAGTGG + Intergenic
953158766 3:40398958-40398980 CAAAATGCTGCTGGTATTACAGG - Intronic
954588751 3:51761547-51761569 AAATATACTGATAGTCTTATGGG + Intergenic
956321629 3:68004003-68004025 CAAAATACTGATAGTATTAGTGG - Intergenic
956617269 3:71184890-71184912 CATAAAAATGATGGTATTAGAGG + Intronic
957903964 3:86534174-86534196 CAAAATACTGGTAGAAATATGGG - Intergenic
958007243 3:87827323-87827345 GAAAATAATTATAGTATAAGTGG - Intergenic
958120416 3:89280232-89280254 GAAAATACTGATATTTTGAGTGG + Intronic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958417690 3:93894180-93894202 TAAAATAGTAATAGTAATAGAGG + Intronic
958893976 3:99809920-99809942 CAAAATACTGTTTCTCTTAGGGG + Intergenic
958896975 3:99840175-99840197 GAAAAAGCTGATAGGATTAGGGG + Intronic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959443128 3:106404295-106404317 CAAAAGAGTGAGAGTCTTAGAGG - Intergenic
960338752 3:116449276-116449298 CAAAATAATAAAAGTATTTGAGG + Intronic
960774852 3:121237942-121237964 CAAAATACTGACAGAAATATGGG - Intronic
962400475 3:135055014-135055036 CAAAATATTAATAGAATTATGGG - Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963278447 3:143356932-143356954 CAAAATAATAATAGTATTCTAGG + Intronic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
966385852 3:179397303-179397325 CAAAATACCAAAAGTATTAGAGG + Intergenic
966476019 3:180347780-180347802 CAAAATAATGATGGTAATTGTGG - Intergenic
966476185 3:180349809-180349831 CCAAATACTGATATGATAAGGGG - Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967599933 3:191374592-191374614 CAATATTCTGATAGTTTTATTGG + Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971500656 4:27314690-27314712 CAAAATAATGATTTTATGAGAGG + Intergenic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
973875994 4:55219022-55219044 CAAAATAAAGTTACTATTAGCGG - Intergenic
973911105 4:55581658-55581680 CCAAATACTGAAAGTAGTTGAGG + Intronic
974437780 4:61878481-61878503 CAAAATACTTATAGACTTACAGG - Intronic
975416923 4:74115082-74115104 CAAAGAAATGATGGTATTAGGGG + Intronic
975440422 4:74404181-74404203 CAAAATGATGATGCTATTAGAGG - Intergenic
976045165 4:80938161-80938183 CATAATCATTATAGTATTAGAGG + Intronic
976787870 4:88842931-88842953 CAAAATACTGAGAGAAATATCGG + Intronic
976840892 4:89431269-89431291 AAAAATATAGATATTATTAGGGG - Intergenic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977434554 4:96976885-96976907 CAGTATGCTGATAATATTAGTGG - Intergenic
978883433 4:113737034-113737056 CAACATAATAATAGTATTTGGGG + Intronic
979058615 4:116026604-116026626 CAAATTCCTTATAGGATTAGGGG - Intergenic
979187820 4:117820457-117820479 TTAAATACTGATTGTGTTAGTGG + Intergenic
980289669 4:130829223-130829245 CAAAATACTAGAAGTATTTGAGG + Intergenic
981241921 4:142487490-142487512 CAAAATACTGACAGATTTTGGGG - Intronic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981412066 4:144443373-144443395 CAAAATGCTGTTAGTAATACGGG - Intergenic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
982334366 4:154216939-154216961 CACAATACCGATATTATTGGTGG - Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
983996135 4:174184653-174184675 CAGAGGACAGATAGTATTAGAGG + Intergenic
984512358 4:180694017-180694039 CAAAATACTAATAGTGATATAGG - Intergenic
985397842 4:189563728-189563750 AAAAAAACTGAGAGCATTAGTGG + Intergenic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
986835365 5:11631218-11631240 CAAAATATTGAAAGTTTTAAAGG + Intronic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988876866 5:35456644-35456666 CAAAATGCTGATGGTGATAGGGG + Intergenic
989157905 5:38361813-38361835 TAAAATACGGATGGTAATAGTGG + Intronic
989527136 5:42466585-42466607 CAAAGTAATGATTGTATTTGGGG - Intronic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991158019 5:63460999-63461021 CAAAGTCCTGAGAGTATTACAGG - Intergenic
993792625 5:92225203-92225225 CAAAATACTGATAGTGAGATGGG - Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994324510 5:98434470-98434492 CAAAATAATGAGAGGATAAGAGG + Intergenic
994812274 5:104535585-104535607 GAAAATACTGAAAGTCTTAGTGG + Intergenic
995227972 5:109724806-109724828 CAAAATACTTATATTTTAAGAGG - Intronic
997483438 5:134207439-134207461 CAAAATTCTGACTTTATTAGGGG - Intronic
999040645 5:148407186-148407208 CAAAATACTGTTGGTTTTAAGGG - Intronic
999073777 5:148775605-148775627 TAGAATATTGATAGTTTTAGAGG - Intergenic
999464111 5:151785227-151785249 CAAAATACTCCTAGTATGACTGG + Intronic
999919368 5:156302509-156302531 CAAAATAAAGAAAGCATTAGTGG - Intronic
1000073141 5:157759881-157759903 CAAAATACTGAGAGTAAAGGAGG - Exonic
1000596763 5:163223643-163223665 CAAAGTACTGAGATTATTACAGG + Intergenic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1003202589 6:3975870-3975892 TCATATACTGATACTATTAGAGG + Intergenic
1004060571 6:12193016-12193038 CAAAATAGGGATAATAATAGTGG + Intergenic
1004678326 6:17866227-17866249 CACAATATTTATAGTATTTGAGG + Intronic
1004999120 6:21223301-21223323 CAAATTTCTGATAGTATAAATGG - Intronic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1008948401 6:57125926-57125948 CAACATACTTATAGTTCTAGGGG - Intronic
1010597245 6:77778749-77778771 CAAAATCCAGTAAGTATTAGGGG + Intronic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1013327828 6:109065272-109065294 CATCATAATAATAGTATTAGGGG - Intronic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1015379526 6:132550915-132550937 TAAATTACTGTTAGTATTATGGG + Intergenic
1016242595 6:141948698-141948720 CAAAATACTTACAGGATAAGGGG + Intergenic
1016920345 6:149286780-149286802 GAAAATACTTATAATATTAAGGG + Intronic
1016959521 6:149659139-149659161 CAAAAAGCTTATAGTATCAGAGG + Exonic
1018442898 6:163829405-163829427 GGAAATACTGATAGTATTTAGGG + Intergenic
1019072276 6:169357353-169357375 CAAAATAATGATTGAATTAAAGG + Intergenic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1019845971 7:3502067-3502089 AAAAATATTAATATTATTAGTGG + Intronic
1020850592 7:13347653-13347675 CTAAGTACTGAGAGTATGAGAGG - Intergenic
1021241738 7:18210245-18210267 CAAAATATTTATAGTCTAAGGGG + Intronic
1021512116 7:21444867-21444889 TAAAATACTTAAAGTAGTAGTGG - Intronic
1023214878 7:37850794-37850816 GACAATACTTAAAGTATTAGAGG - Intronic
1028206442 7:88022912-88022934 CAAACTATTGAAACTATTAGTGG + Intronic
1030015183 7:105212134-105212156 TAAAATATTAATAGTACTAGTGG - Intronic
1030324390 7:108204239-108204261 CAAAATAATGAGAGAATGAGGGG - Intronic
1030788754 7:113696760-113696782 CAAAATATTCTTAGTATAAGAGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031780111 7:125951059-125951081 AAAAATACTGATGGTATTTTAGG - Intergenic
1032399633 7:131615062-131615084 AAAACAACTGATAGTATTTGTGG + Intergenic
1033161506 7:139001174-139001196 AAAAATAATGATAGTGTCAGAGG + Intergenic
1037444380 8:18950334-18950356 CAAAATACAAAAAGTATTTGAGG - Intronic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1039510544 8:38088593-38088615 CAAAAGACTGCTAATATTATTGG - Intergenic
1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG + Intergenic
1041697649 8:60753587-60753609 CAAAAAACTGATCTTATTATTGG - Intronic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044244924 8:89932136-89932158 CAAACTACTGAAACTACTAGAGG + Intergenic
1045050589 8:98320677-98320699 CAAAATGCTGATAGCAATACGGG - Intergenic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046533518 8:115478003-115478025 CACAGTATTGATTGTATTAGAGG - Intronic
1048243898 8:132772881-132772903 CTAATTACTCATAGTATTTGAGG - Intergenic
1048860138 8:138718684-138718706 CAACATACTCATAGTCCTAGAGG - Intronic
1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG + Intronic
1051151692 9:14086548-14086570 CAAAATACTGAAAATATTGCTGG + Intronic
1051162824 9:14227871-14227893 CAAAATACTGAGAGGTTGAGTGG - Intronic
1051210834 9:14741356-14741378 CAAAATACTGTTATTAGTAGAGG - Intronic
1051558474 9:18411651-18411673 CAAAATACTGATATTTTTTAAGG - Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1051929320 9:22366334-22366356 AATAATATTGATAGTAATAGTGG - Intergenic
1051971709 9:22895947-22895969 CACAATTCTGATAGTTTTGGGGG - Intergenic
1052114109 9:24627862-24627884 CTATATACTGATACTTTTAGTGG + Intergenic
1052364435 9:27596155-27596177 AAAAATACTGATACTGTTATGGG - Intergenic
1055160365 9:73119305-73119327 CAAGATCCTGATAATATGAGTGG + Intergenic
1056506832 9:87265594-87265616 CAAAATAATGAAGGTCTTAGTGG + Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1186212647 X:7266083-7266105 CAAAGCAATGGTAGTATTAGTGG + Intronic
1187119352 X:16388430-16388452 CAAGACATTGATACTATTAGAGG - Intergenic
1189454202 X:41169763-41169785 CAAGATACTGAAAGTAATACAGG + Intronic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193968945 X:88026297-88026319 CATAAAAGTGATGGTATTAGGGG - Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194528410 X:95010887-95010909 AAAATTACTGATACTATTAGAGG + Intergenic
1194730918 X:97454447-97454469 CAAAATATTAATAGTCTTTGTGG + Intronic
1195431339 X:104792837-104792859 TAAGATATTTATAGTATTAGGGG + Intronic
1195527904 X:105914218-105914240 CAGAGGACTGTTAGTATTAGGGG - Intronic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197390135 X:125853119-125853141 CAAAGAACTGACTGTATTAGCGG - Intergenic
1197410599 X:126110855-126110877 CACAAGACTGATAGTACTAAGGG + Intergenic
1197419720 X:126223810-126223832 AAAAATACAGAAAGTACTAGGGG - Intergenic
1197995840 X:132371818-132371840 CAAAATACTGATGGTATATTTGG + Intronic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1198732701 X:139749978-139750000 CACAACACTGAAAGTCTTAGGGG + Intronic
1199472433 X:148209835-148209857 CAAAATACTGATAGTTATTATGG + Intergenic
1199775620 X:151008884-151008906 AAAAATATTGATAGCAATAGTGG + Intergenic
1199907817 X:152252595-152252617 AATAATACTTATACTATTAGTGG + Intronic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1201017177 Y:9617321-9617343 CAAAAGACTAAAAGTATTAAGGG + Intergenic