ID: 956322050

View in Genome Browser
Species Human (GRCh38)
Location 3:68008015-68008037
Sequence GGCCGCCCCGGGAGAAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 329}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956322037_956322050 27 Left 956322037 3:68007965-68007987 CCTGCACCAGGCTGCAGCGAGCG 0: 1
1: 0
2: 0
3: 16
4: 164
Right 956322050 3:68008015-68008037 GGCCGCCCCGGGAGAAGGGGTGG 0: 1
1: 0
2: 0
3: 38
4: 329
956322043_956322050 -2 Left 956322043 3:68007994-68008016 CCTGCTGGGTGCTGGAGCTCGGG 0: 1
1: 0
2: 2
3: 49
4: 321
Right 956322050 3:68008015-68008037 GGCCGCCCCGGGAGAAGGGGTGG 0: 1
1: 0
2: 0
3: 38
4: 329
956322038_956322050 21 Left 956322038 3:68007971-68007993 CCAGGCTGCAGCGAGCGCGCAAG 0: 1
1: 0
2: 0
3: 4
4: 86
Right 956322050 3:68008015-68008037 GGCCGCCCCGGGAGAAGGGGTGG 0: 1
1: 0
2: 0
3: 38
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956322050 Original CRISPR GGCCGCCCCGGGAGAAGGGG TGG Intronic