ID: 956322570

View in Genome Browser
Species Human (GRCh38)
Location 3:68014088-68014110
Sequence GAATGTACACAGATTCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956322570_956322574 19 Left 956322570 3:68014088-68014110 CCAAGCTGAATCTGTGTACATTC 0: 1
1: 0
2: 1
3: 12
4: 152
Right 956322574 3:68014130-68014152 CCACTTTTGTGGATGAAGAATGG 0: 1
1: 0
2: 1
3: 26
4: 226
956322570_956322572 8 Left 956322570 3:68014088-68014110 CCAAGCTGAATCTGTGTACATTC 0: 1
1: 0
2: 1
3: 12
4: 152
Right 956322572 3:68014119-68014141 TTTCTTATTTTCCACTTTTGTGG 0: 1
1: 0
2: 7
3: 149
4: 1367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956322570 Original CRISPR GAATGTACACAGATTCAGCT TGG (reversed) Intronic
901518683 1:9767003-9767025 GAATGTTCACACAGTGAGCTGGG + Intronic
901819092 1:11814709-11814731 GAAGAGGCACAGATTCAGCTTGG - Intronic
904867557 1:33592786-33592808 GAATGTACAAAAAATTAGCTGGG + Intronic
908130069 1:61066488-61066510 TAATGGATACAGAGTCAGCTTGG + Intronic
908193094 1:61723446-61723468 GGATGTTCCCAGATTCAGTTAGG - Intronic
909168332 1:72257873-72257895 GAATGTTCAGAGATTTATCTGGG - Intronic
910101575 1:83583384-83583406 GAGTGCACACACACTCAGCTGGG + Intergenic
917665237 1:177219866-177219888 GTATATACAGAGACTCAGCTGGG + Intronic
918016468 1:180638255-180638277 CATTGTACACAGATACAGATGGG + Intronic
919919070 1:202157651-202157673 CAAAGTACACAGTTTCAGCCAGG - Intronic
921661235 1:217805417-217805439 AAATGTACAAAGTTTCAGTTAGG + Intronic
921925325 1:220706217-220706239 GAAGATGCCCAGATTCAGCTAGG - Intergenic
922480471 1:225937164-225937186 CAATGCACACATTTTCAGCTGGG - Exonic
923881090 1:238104841-238104863 GAATGTAGGCAGATTCAGCAGGG + Intergenic
1063826555 10:9904981-9905003 GAAAGTATACAAATTTAGCTTGG + Intergenic
1064087054 10:12353030-12353052 GAAAGTACACAGAGGCGGCTGGG - Intronic
1064943422 10:20760395-20760417 GCACATCCACAGATTCAGCTGGG - Intergenic
1066601343 10:37110718-37110740 GAATGTACCCAGATTTCTCTGGG + Intergenic
1066808604 10:39293215-39293237 GAATCTGCACAGATATAGCTGGG - Intergenic
1068032986 10:51725974-51725996 GAATGTAAACATATTCTCCTAGG + Intronic
1068378907 10:56222045-56222067 GAATGTGCAAAGATTGAGTTAGG - Intergenic
1069026179 10:63544648-63544670 GAAGGTACACAGAAGCAGATGGG + Intronic
1069114756 10:64490942-64490964 AAAAGTACACAGATTCAATTAGG - Intergenic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1072900865 10:99405211-99405233 GAATATACACACTTTCAGCTAGG + Intronic
1074114740 10:110447295-110447317 GAAGGGACACAGAGTCAGCTAGG + Intergenic
1075358625 10:121808291-121808313 GAAAGTACACATATCAAGCTGGG + Intronic
1077608695 11:3630050-3630072 GAAAGTACACACAATCAACTAGG - Intergenic
1077809773 11:5625307-5625329 GAATGGAAATAGATTCAGCCTGG - Intronic
1080784006 11:35458258-35458280 GAATGAACACACATTCATCTGGG - Intronic
1081620390 11:44615849-44615871 TAATGGGCACACATTCAGCTTGG - Intronic
1084874411 11:72120231-72120253 TAATGGATACAGTTTCAGCTGGG + Intronic
1087624109 11:100576964-100576986 GAATGAATACAGAATTAGCTGGG + Intergenic
1089677383 11:120098917-120098939 AAATGCACACAGATGCAGCTGGG - Intergenic
1090602541 11:128388258-128388280 CAATGTACACAAATACAGCTGGG - Intergenic
1093254821 12:16854064-16854086 GTATGTAGACAGATTAAACTTGG + Intergenic
1097363602 12:58685986-58686008 GAATGAACTGAGATTCAGGTGGG - Intronic
1097857002 12:64473937-64473959 AAACGGACACAGATTCAGGTAGG + Intronic
1103831906 12:123786976-123786998 GAAAGTACACAGAATTAGCCGGG + Intronic
1107541699 13:41394888-41394910 GAATGGATTCAGATTCTGCTGGG + Intergenic
1111200983 13:84936820-84936842 GCATGAACACAGTTTCTGCTTGG + Intergenic
1111996128 13:95167829-95167851 GAATGGACACACATTCATCCTGG + Intronic
1114324288 14:21573375-21573397 AAAGGTACAAAGTTTCAGCTGGG + Intergenic
1117418314 14:55518803-55518825 GTATGTACAGAGATTTATCTGGG - Intergenic
1117718906 14:58608856-58608878 GCATGAACACAGATTGATCTGGG - Intergenic
1121026755 14:90621597-90621619 GAAGCCACACAGGTTCAGCTGGG + Intronic
1122564425 14:102642149-102642171 CAATGGACACAGACGCAGCTGGG - Intronic
1125712453 15:41797953-41797975 GAATTTAAACAGGTTCAGCCGGG + Intronic
1129492087 15:75937346-75937368 GAAAGTACACAAAATTAGCTGGG + Exonic
1137848069 16:51711446-51711468 GAATCTACAGAGCTTCAGTTAGG - Intergenic
1139394418 16:66629165-66629187 ATTTGTACACAGAATCAGCTGGG + Intronic
1141739057 16:85878176-85878198 GAAAGCACACACTTTCAGCTGGG + Intergenic
1143314910 17:6025222-6025244 GAAGAGACACAGCTTCAGCTTGG - Intronic
1144515323 17:15913601-15913623 GAAGGTTCAGAGATTCTGCTTGG - Intergenic
1147704096 17:42414194-42414216 GAATGAAAACAGATTAATCTGGG - Intronic
1150272200 17:63873736-63873758 AAATGTACACAGAAACAGGTGGG - Exonic
1150275749 17:63896633-63896655 AAATGTACACAGAAACAGGTGGG - Exonic
1150279165 17:63918897-63918919 AAATGTACACAGAAACAGGTGGG - Intergenic
1155894197 18:31303071-31303093 GAATGTATGCAGATTTACCTGGG + Intergenic
1156182911 18:34626768-34626790 GAAGCTACACAGATGCAGCCTGG + Intronic
1158049737 18:53202316-53202338 AAATTTACCCAGATTCAACTAGG - Intronic
1159025273 18:63177803-63177825 GACTGCAAACAGAGTCAGCTTGG - Intronic
1168657373 19:58140571-58140593 AAATGTACAAAAAATCAGCTGGG - Intronic
925338082 2:3113307-3113329 GAAGGTTCAGAGCTTCAGCTGGG + Intergenic
926729277 2:16023166-16023188 GAATACACACAGCCTCAGCTGGG - Intergenic
928846721 2:35682978-35683000 AAAGGTAGACAGATTGAGCTCGG - Intergenic
930172883 2:48269121-48269143 GGTTGTGCACAGATTCTGCTTGG - Intergenic
932770954 2:74500529-74500551 GAATGTCCCAAGATCCAGCTGGG - Intronic
933195678 2:79386856-79386878 GAATCTTCACACATTCATCTTGG + Intronic
933495841 2:83049352-83049374 GGATGTACACAGGTCCATCTAGG - Intergenic
934684049 2:96307372-96307394 TCATGTTCACAGATGCAGCTGGG + Intergenic
936064473 2:109320011-109320033 GAATGGAAACAGCTCCAGCTGGG - Intronic
939064736 2:137469106-137469128 GAATCTAGACAGATCCAGATAGG - Intronic
941490888 2:166140992-166141014 CAATGTGCACAGAATCACCTGGG - Intergenic
941781427 2:169449825-169449847 GAAAATACAAATATTCAGCTGGG + Intergenic
942111532 2:172687699-172687721 AAATGTCCACAGTTACAGCTGGG + Intergenic
944714422 2:202364579-202364601 AATTGTACACACATACAGCTGGG + Intergenic
945157511 2:206855149-206855171 GAATGGGCACAGTTTCAGTTTGG + Intergenic
945337350 2:208608350-208608372 GGCTGTACACACATTCAGATGGG + Intronic
946842745 2:223834938-223834960 GATTGAACACAGATGCAGATAGG - Intronic
1169687098 20:8287649-8287671 GGATGTACAAAGAATCAGCATGG + Intronic
1171029421 20:21663919-21663941 GCATGGAGACAGATGCAGCTGGG + Intergenic
1171467648 20:25342057-25342079 AAATGTTCACAGCTTCAGCCTGG + Intronic
1172913828 20:38429400-38429422 CAATTTCCACAGGTTCAGCTTGG + Intergenic
1176700352 21:10040526-10040548 AAATATACACACATTCAGCCGGG + Intergenic
1181927451 22:26371470-26371492 GAATATACACAAATGTAGCTGGG + Intronic
950213600 3:11141830-11141852 GAATGTACATAGCATCATCTAGG - Intronic
953087254 3:39681712-39681734 GAATGTCCACAGGTTTATCTAGG - Intergenic
954198930 3:49012842-49012864 GAAGGTGCACAGCTTGAGCTGGG + Exonic
955845825 3:63161735-63161757 GATTATACTCAGATTCATCTGGG + Intergenic
956189654 3:66596528-66596550 GCATGTACAAAGCTTCTGCTGGG + Intergenic
956322570 3:68014088-68014110 GAATGTACACAGATTCAGCTTGG - Intronic
957991139 3:87628614-87628636 GAAAGAACTCAGATTCAGATAGG - Intergenic
959673265 3:109003742-109003764 GGTTGTAAACAGATTCAGCTTGG + Intronic
961311321 3:126003905-126003927 GAGTGCACACAAATTCGGCTGGG - Intergenic
963483060 3:145901741-145901763 GAAGTTAGACAGATTCAGTTTGG - Intergenic
965966439 3:174496176-174496198 GTATGTGCACAGACTGAGCTGGG - Intronic
967135981 3:186512970-186512992 GAATGGCCAAAGATCCAGCTGGG - Intergenic
968722310 4:2216722-2216744 GAAGGTACAGTGATTCATCTTGG - Intronic
969888835 4:10240787-10240809 GAATGTGAAGAGATTCAACTGGG - Intergenic
970159208 4:13172210-13172232 GGATGTCCACAAATTCAACTGGG + Intergenic
970862955 4:20724326-20724348 GAGTGTATACAGATTCAGTAGGG + Intronic
976399096 4:84587534-84587556 GGATGACCACAGATTCAGGTCGG + Intronic
977544256 4:98358208-98358230 GTATGTGCACAGAATCATCTAGG - Intronic
979606188 4:122641494-122641516 ATATGGACACAGATACAGCTAGG + Intergenic
982082561 4:151805063-151805085 AAATATACACTGATTCTGCTGGG + Intergenic
984896532 4:184546510-184546532 GTATGTACATGGTTTCAGCTGGG + Intergenic
985206237 4:187540010-187540032 GAATGTCAACTGATTCAACTTGG - Intergenic
986465225 5:8014364-8014386 TAATGTAAACATATTCATCTAGG + Intergenic
993880014 5:93350778-93350800 CAATGTCTACAGATTCATCTGGG - Intergenic
994755461 5:103789153-103789175 TAAATTACCCAGATTCAGCTGGG - Intergenic
995130804 5:108628510-108628532 AAAAGAACACAGAGTCAGCTAGG + Intergenic
996638749 5:125728145-125728167 GAATGTACACACATGCTGTTAGG - Intergenic
999417884 5:151415807-151415829 GAAAGTACACAGAGTCAGGCTGG + Intergenic
1000924378 5:167176003-167176025 GAAAGACCACAGATACAGCTGGG - Intergenic
1001623696 5:173111518-173111540 GAAAGAATACAGATTCAGCTGGG - Intronic
1001677216 5:173528601-173528623 GGATGTGCACACATCCAGCTAGG - Intergenic
1002703189 5:181141880-181141902 GAGTATACACAGTTTCAGTTAGG - Intergenic
1011706862 6:90009529-90009551 GGATGTACATCAATTCAGCTGGG - Intronic
1012836926 6:104281004-104281026 GAATCTTTCCAGATTCAGCTTGG - Intergenic
1014793005 6:125695865-125695887 AAAGGTACACAGTTTCAGTTAGG + Intergenic
1015194591 6:130511086-130511108 GAAATTACACAGTCTCAGCTGGG + Intergenic
1016336696 6:143013245-143013267 GGATGTAAACAGATTTACCTTGG - Intergenic
1017313936 6:153006914-153006936 GTATGTCCACAGATTCACTTAGG - Exonic
1017704971 6:157113720-157113742 GAATGTACAGTGATATAGCTTGG - Intronic
1020383217 7:7568047-7568069 GAATGAACACAGAATCAGCATGG + Exonic
1022671422 7:32459803-32459825 GAATATCCAAAGATGCAGCTGGG + Intergenic
1025201929 7:56967710-56967732 GCGTGCACACAGATTCAGATAGG + Intergenic
1025670017 7:63609218-63609240 GCGTGCACACAGATTCAGATAGG - Intergenic
1026172309 7:67964725-67964747 TAAGAAACACAGATTCAGCTGGG + Intergenic
1026436881 7:70406854-70406876 TACTGTACACAGATGCGGCTGGG - Intronic
1027337105 7:77163028-77163050 GAATTTGTACAGATTCAGCATGG + Intronic
1027448501 7:78302574-78302596 GAATATAAACAGCTTCATCTGGG + Intronic
1028074744 7:86497948-86497970 GAATGGACTTAGATTCAGCCTGG + Intergenic
1029778694 7:102708082-102708104 GAATTTGTACAGATTCAGCATGG - Intergenic
1030007716 7:105135013-105135035 GAATATACACTGATTCACCTGGG + Intronic
1030056924 7:105591271-105591293 GAGAGTACACAGCTTCTGCTTGG + Intronic
1036595934 8:10211982-10212004 GAATCTTCACAAATTAAGCTTGG - Intronic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1043651566 8:82600574-82600596 GCATGTACACAGACTCAGCTGGG - Intergenic
1044427142 8:92064990-92065012 AGATGCACACACATTCAGCTAGG - Intronic
1044857465 8:96491482-96491504 GAATGCTCTCTGATTCAGCTTGG - Intergenic
1048374441 8:133810699-133810721 GAAGCTACACAGATTCAGCAAGG + Intergenic
1048439270 8:134447948-134447970 GAAGGTACAGAGATCCAGCTGGG - Intergenic
1048617823 8:136098302-136098324 GAATGTAAACATAGTCACCTGGG + Intergenic
1050035096 9:1426788-1426810 GAATGTACAGAGTTGCAGCATGG - Intergenic
1050311128 9:4354241-4354263 GAAAGTACTCAGTTTCAGATGGG - Intergenic
1050961566 9:11739836-11739858 CAAAGTTCACAGATTCACCTGGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053062800 9:35044831-35044853 CAATCTTCACAGCTTCAGCTAGG - Exonic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053768527 9:41437891-41437913 AAATATACACACATTCAGCCGGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057260795 9:93582128-93582150 GCATGGACACAGAAGCAGCTAGG + Intronic
1057513779 9:95703695-95703717 GAGTGGAGACAGCTTCAGCTTGG + Intergenic
1057618297 9:96613334-96613356 GAATGTTCCCAGTTTCTGCTGGG - Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057709700 9:97428212-97428234 GAATGTTCCCAGATTCAGGCGGG - Intronic
1187997767 X:24946973-24946995 GAAAGTAGACAGATTAAGGTGGG - Intronic
1188863984 X:35291782-35291804 GAAAGTATGCAGATTCAGCAGGG + Intergenic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1195304351 X:103564901-103564923 GTATGTACACAGGTTTAACTAGG - Intergenic
1199447251 X:147939735-147939757 GAAAGTACAAAAATTTAGCTGGG + Intronic
1200863688 Y:8019890-8019912 GAATGAAAACAGTGTCAGCTGGG + Intergenic
1202048950 Y:20761190-20761212 AAATGTTCTCACATTCAGCTTGG + Intronic