ID: 956329426

View in Genome Browser
Species Human (GRCh38)
Location 3:68089179-68089201
Sequence CAGGGCTAGCAATTTAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956329423_956329426 -2 Left 956329423 3:68089158-68089180 CCTGAAACTCAAGAGAAAGTTCA 0: 1
1: 0
2: 4
3: 25
4: 288
Right 956329426 3:68089179-68089201 CAGGGCTAGCAATTTAAATTTGG 0: 1
1: 0
2: 4
3: 26
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956329426 Original CRISPR CAGGGCTAGCAATTTAAATT TGG Intronic
903706922 1:25292735-25292757 TAGGGCTAGGGATATAAATTTGG + Intronic
903720316 1:25400612-25400634 TAGGGCTAGGGATATAAATTTGG - Intronic
905488311 1:38323411-38323433 CTGGGCTAGAGATTTAGATTTGG + Intergenic
907347544 1:53795340-53795362 CTGGGCTAGAAATGTAACTTTGG - Intronic
907646820 1:56252632-56252654 CAGGGCTAGAAACATAAATTTGG + Intergenic
910070867 1:83212294-83212316 CTGGACTAGAAATTTATATTTGG - Intergenic
910092418 1:83480774-83480796 CAGGGCTGGAGATGTAAATTTGG - Intergenic
914701544 1:150138482-150138504 CAGGACTAGAAATATAAATCTGG - Intronic
915057418 1:153147535-153147557 CAGCTCTAGGCATTTAAATTGGG + Intergenic
916309711 1:163383118-163383140 CAGGTCTAGAGATATAAATTTGG + Intergenic
916417642 1:164607607-164607629 CAGGGCTAGAGACATAAATTTGG + Intronic
916577061 1:166076874-166076896 CAGGGCTAGGGATGTAAATTTGG + Intronic
918087380 1:181257269-181257291 CAGAGCTAGAAATACAAATTTGG + Intergenic
918433775 1:184489560-184489582 CAGTGCTAGGAATTTATCTTAGG + Intronic
919048043 1:192478592-192478614 CAGAGTTAGAAATTAAAATTAGG - Intergenic
920159702 1:203986961-203986983 CTGGGCTAGAAGTTTAGATTTGG + Intergenic
920839725 1:209544534-209544556 CAGGGCTACCAAGTGAAAGTGGG - Intergenic
921353219 1:214259255-214259277 CAGGGCTAGAGATTTAAAACTGG - Intergenic
923205556 1:231755470-231755492 CAGGGCTAGAGATAGAAATTTGG - Intronic
1063674332 10:8126601-8126623 CAGGGCTAGAGATCTGAATTTGG + Intergenic
1066761414 10:38757059-38757081 CAGGCATAGAAATTTAGATTGGG + Intergenic
1066960170 10:42215365-42215387 CAGGCATAGAAATTTAGATTGGG - Intergenic
1067170317 10:43900530-43900552 CAGAGCAAGCAATTTGACTTGGG + Intergenic
1068683040 10:59840552-59840574 CTGGGCTAGAGATATAAATTTGG - Intronic
1068711215 10:60136098-60136120 AAGGGCTTGCAATTGAAACTGGG - Intronic
1069472940 10:68709071-68709093 GAGGGGAAGCAATTTATATTTGG + Intergenic
1072240825 10:93494577-93494599 CAGGGCTAGCAATGGCAATTAGG + Intergenic
1073419021 10:103408872-103408894 CAGGACTAGCAGATTTAATTTGG + Intronic
1074796341 10:116949167-116949189 CAAGGATAGCTATTTAAGTTAGG + Intronic
1076306984 10:129472391-129472413 CATGGATAGAAATTTTAATTTGG + Intronic
1078620746 11:12905511-12905533 GAGGGAAGGCAATTTAAATTCGG + Intronic
1079944652 11:26726586-26726608 TAGGGTTTGCAATTTAAATAGGG - Intergenic
1080134864 11:28842886-28842908 CAGGGCAGGAAACTTAAATTGGG - Intergenic
1082198139 11:49328070-49328092 CTGGGCTAGGAATATAAACTTGG - Intergenic
1083415363 11:62522051-62522073 CAGGTCAGGCATTTTAAATTTGG + Exonic
1085426732 11:76411403-76411425 CTGAGCTAGAAGTTTAAATTGGG - Intronic
1085652832 11:78283966-78283988 TAGGGCTAGAGATATAAATTTGG - Intronic
1086295789 11:85366128-85366150 CAGAGCTAGCAATTACATTTTGG - Intronic
1086314293 11:85574260-85574282 CAAGGTTAGAAATTTAAATTTGG - Intronic
1086657673 11:89380075-89380097 CTGGGCTAGGAATATAAACTTGG + Intronic
1087751430 11:102011495-102011517 CAGAGTTGGCATTTTAAATTTGG - Intergenic
1089223982 11:116900066-116900088 CAGGGCCAGACATATAAATTTGG - Intronic
1089411417 11:118246276-118246298 CATGGCTAGTAATATAGATTGGG - Intronic
1090991982 11:131825941-131825963 CTGGGCTAGAAATATAAATTTGG + Intronic
1093143287 12:15535242-15535264 CTGGGCTGGAAATATAAATTTGG + Intronic
1093201640 12:16194189-16194211 CAGGGTAAGAAATTTCAATTTGG - Intronic
1093552833 12:20435845-20435867 CTGGGCAAACAATTTAAATAAGG + Intronic
1093907274 12:24707858-24707880 CAGGGCTGGACATATAAATTTGG + Intergenic
1093907373 12:24709162-24709184 CAGGGCTGGACATATAAATTTGG - Intergenic
1094043527 12:26142638-26142660 CAGGGCTAGAGATTTATATCTGG + Intronic
1094149252 12:27264133-27264155 CAGGCATAGAAATTTAGATTGGG + Intronic
1097356833 12:58611684-58611706 CAGGTCTATCAAACTAAATTGGG + Intronic
1098719483 12:73878314-73878336 CAGAGAGAGCAATTAAAATTTGG - Intergenic
1100035697 12:90248772-90248794 CAGGGTTAGAAAGATAAATTTGG - Intergenic
1100905736 12:99296558-99296580 GAGGGATATAAATTTAAATTGGG - Intronic
1103346585 12:120255103-120255125 CAGGGGTGGAAATATAAATTTGG + Intronic
1106090713 13:26590946-26590968 CAGGACTTGCAGTTTTAATTGGG + Intronic
1109636599 13:65126581-65126603 CAGGGATACAAATTTTAATTAGG + Intergenic
1109723883 13:66314549-66314571 AAGGGCTAGAAATATAAATTGGG - Intronic
1110292301 13:73821272-73821294 CTGAGATAGCAATTGAAATTGGG - Intronic
1110339720 13:74375328-74375350 CAGACCTAGAAATTTAAATCTGG + Intergenic
1111047463 13:82833306-82833328 CAGGCATAGCAATTTACATTTGG + Intergenic
1111415270 13:87933039-87933061 CAGGGTTAGCATTGTAAAGTGGG - Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1115819310 14:37197240-37197262 AACTGCTAGTAATTTAAATTTGG - Intergenic
1117283967 14:54268091-54268113 CAGGGCTAGCAAAGGAAACTGGG + Intergenic
1120033223 14:79666404-79666426 TTTGGCTAGCATTTTAAATTAGG + Intronic
1122493773 14:102137626-102137648 CAGGCCTAGTTATTTAGATTTGG + Intronic
1124550768 15:30679468-30679490 CAGGGCTAGAGATTTAAATTTGG + Intronic
1124680482 15:31726207-31726229 CAGGGCTAGAGATTTAAATTTGG - Intronic
1127520858 15:59741832-59741854 CAGGGCTGGAAATTTAATTATGG - Intergenic
1129025434 15:72568833-72568855 CAATGATAGCAATTTAAAATAGG - Intronic
1131499173 15:92944912-92944934 CTGGGCTGGAGATTTAAATTTGG + Intronic
1131783974 15:95891531-95891553 CAGGCCCAGATATTTAAATTTGG + Intergenic
1133309038 16:4830948-4830970 CAGGACTAGAAATGTAGATTTGG - Intronic
1133925807 16:10191287-10191309 CAGAGCCAGGAATTTTAATTGGG - Intergenic
1135198732 16:20418279-20418301 CAGGGCTGGGAATTTTAGTTGGG + Intronic
1135352950 16:21745192-21745214 CAAGCCTAGCAATTTTGATTGGG + Intronic
1135451436 16:22561315-22561337 CAAGCCTAGCAATTTTGATTGGG + Intergenic
1135806064 16:25543815-25543837 GATGGCTGGCAATTTACATTAGG - Intergenic
1146424852 17:32727539-32727561 CAGAGCTAGAAATTTAACTGAGG + Intronic
1153707904 18:7766153-7766175 CAGGACTAGCAATTCAAACAAGG - Intronic
1163588286 19:18175767-18175789 CAGGGCTAGGACTTGAATTTGGG - Intronic
1165082441 19:33316469-33316491 CAGGGCCAGCAATAAAAATAAGG - Intergenic
927724353 2:25409839-25409861 CAGGGCTAGCAATGTAGACTTGG - Intronic
928712898 2:34027693-34027715 TAGGACTAGAAATTTAAATTTGG - Intergenic
928730407 2:34225218-34225240 CAGGGCTTGAAATAAAAATTTGG + Intergenic
928895424 2:36256943-36256965 CTGGTCTAGAGATTTAAATTTGG - Intergenic
928957530 2:36886067-36886089 CAGGGCTAGAAATTTCCTTTTGG + Intronic
929657186 2:43745429-43745451 CAGGTCTAGCTATTTGATTTTGG - Intronic
929977382 2:46648098-46648120 CAGGCCAAACAATTTAAAATTGG + Intergenic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
931127485 2:59294153-59294175 CAGGGCTCGCAACTTAGCTTGGG - Intergenic
932102530 2:68913716-68913738 CTGGGCTGGAAATGTAAATTTGG + Intergenic
932796734 2:74702185-74702207 GAGGGCTAGAGATATAAATTGGG - Intergenic
933306946 2:80612833-80612855 AAGTGCTAGCTATTTCAATTTGG + Intronic
934463106 2:94232438-94232460 CAGGCATAGAAATTTAGATTGGG + Intergenic
934496826 2:94809862-94809884 CAGAGCTAGAAATGTAGATTAGG - Intergenic
938241017 2:129742335-129742357 CAGGGCTGGCAATTTAGTTAGGG + Intergenic
939222691 2:139323186-139323208 CAGGATTTGAAATTTAAATTTGG + Intergenic
941280734 2:163547643-163547665 CTAGGCTAAAAATTTAAATTAGG - Intergenic
943745957 2:191463172-191463194 CAGGGATAGTAACTTAAATATGG + Intergenic
943885514 2:193212091-193212113 CAGCTGTAGAAATTTAAATTAGG + Intergenic
944058817 2:195549682-195549704 CTGGGCTGGAAATATAAATTTGG + Intergenic
944276631 2:197846287-197846309 CAGGACTGGCAAATTAGATTTGG + Intronic
944454951 2:199883763-199883785 CAGGGCTATCAATTGAGAGTAGG - Intergenic
945712475 2:213316045-213316067 CAGGGTTGGCAATTTAAATTTGG - Intronic
1168990297 20:2089489-2089511 GAGGGCCAGCAATCTAAATTAGG + Intergenic
1169254716 20:4088068-4088090 CATGGCAGGCAATTTAAAATGGG - Intergenic
1169325232 20:4670413-4670435 CAGGGCTAGAGATGCAAATTTGG + Intergenic
1169576023 20:6962334-6962356 CAGGAATAGCAATCTAAATGTGG - Intergenic
1170107856 20:12771443-12771465 CAGACCTGGAAATTTAAATTTGG + Intergenic
1170384735 20:15804042-15804064 CTGGGTTAGCACATTAAATTAGG - Intronic
1173165755 20:40686196-40686218 CAGCGCCAGCAATTTCAAATGGG + Exonic
1174111943 20:48203190-48203212 CAGGGTTGGCACTTTAAATGGGG - Intergenic
1176594153 21:8675479-8675501 CAGGCATAGAAATTTAGATTGGG + Intergenic
1178244878 21:30940969-30940991 CAGGTCTGGGAATTTTAATTTGG - Intergenic
1180277007 22:10652609-10652631 CAGGCATAGAAATTTAGATTGGG + Intergenic
1182518225 22:30870976-30870998 CTGGGCTAGCTACTTAACTTGGG - Intronic
1183525773 22:38321632-38321654 CAGCGCCAGGATTTTAAATTGGG - Intronic
950324250 3:12090466-12090488 CAGAGCCAGAAATTTAAACTTGG - Intronic
953600605 3:44360112-44360134 CAGAGATGGCAATTTAAAATAGG - Intronic
955093399 3:55773954-55773976 CAGGGGTAGCAACCCAAATTTGG - Intronic
956329426 3:68089179-68089201 CAGGGCTAGCAATTTAAATTTGG + Intronic
956733262 3:72216145-72216167 CAGGGTTAGAAATAGAAATTTGG - Intergenic
957008818 3:74982293-74982315 CAGGGATAGCAATTGAGATGAGG - Intergenic
957585319 3:82125110-82125132 CAAGGCTACCAAATTAAATTGGG - Intergenic
957849038 3:85781111-85781133 CATAGGTAGCAATTTAAACTGGG - Intronic
958078111 3:88710525-88710547 AAGGGCTAGCTGTGTAAATTTGG + Intergenic
959000389 3:100957489-100957511 CAGGGCTAGAGATATAAATTTGG + Intronic
959639402 3:108615396-108615418 CTTGGCTAGAAATGTAAATTTGG + Intronic
962300564 3:134238782-134238804 CAGCCCTAGCAATTTGACTTGGG - Intronic
963708396 3:148717386-148717408 CAGGGCCAGCAACTCAAATTTGG + Intronic
964203443 3:154144132-154144154 CAGGGGGAGCAACTTAATTTAGG + Intronic
966075400 3:175930851-175930873 CAGTAGTAGCAATTTAAATTGGG - Intergenic
966742851 3:183250278-183250300 CTGGGCTAGAAATATAAATCAGG + Intronic
971210753 4:24613765-24613787 TAGGGCTGGAAATGTAAATTTGG + Intergenic
971355719 4:25893674-25893696 GAGGGTCAGCAATTTATATTGGG - Intronic
976710316 4:88063725-88063747 CAGGTCTATCAACTTAAATGAGG + Intronic
976879426 4:89900746-89900768 CAAGGCTAGAGATATAAATTTGG + Intronic
977539300 4:98297237-98297259 AAGGGCTAGCAAATTACCTTAGG - Intronic
978131467 4:105203148-105203170 AAGGGCTATCAATTTCAAATTGG + Intronic
978843764 4:113247636-113247658 CAAGGCTTGCAAGTTAAATAGGG + Intronic
979369468 4:119867083-119867105 CTGGGCTGGAAATATAAATTTGG + Intergenic
979609666 4:122675770-122675792 CAGGGTTAGAATTTTAAAATTGG - Intergenic
979957610 4:126973872-126973894 CATGGCTAACAATATAAATGTGG + Intergenic
980191459 4:129530080-129530102 CAGGGCTAGACATATAAAATTGG - Intergenic
982265572 4:153535371-153535393 CTGGGCTAGAGATGTAAATTTGG + Intronic
982337999 4:154261139-154261161 GAGGCCTAGAAATTTAATTTAGG + Intronic
984279499 4:177652220-177652242 CAGGTTTATCAATTTATATTTGG + Intergenic
984283842 4:177704819-177704841 CAAGGGTAGCAGTTTAAACTAGG - Intergenic
984786241 4:183569972-183569994 TTGGGCTAGCAATGTTAATTTGG - Intergenic
985297567 4:188451868-188451890 CAGGGCTGGGAATTTATCTTTGG + Intergenic
990910527 5:60846997-60847019 CTGGGCTAGCAATATAAATCTGG + Intergenic
991248662 5:64534775-64534797 CAGGGCTATAAATTTAAATATGG + Intronic
991325885 5:65431858-65431880 CAGGGCTAGAGATGTATATTTGG + Intronic
991448065 5:66721653-66721675 CAGAGCTAGTGATATAAATTCGG - Intronic
992536870 5:77715060-77715082 GAGGGTTTGCAATTTAAAATAGG + Intronic
992614969 5:78538939-78538961 CAGAGCTAGGAATTTGAAGTAGG - Intronic
993929196 5:93917160-93917182 TAGGGCTAGCATTTGAACTTGGG + Intronic
995579183 5:113576157-113576179 CTGGGCTAGCAATACAAATTTGG + Intronic
996330949 5:122328264-122328286 CAGGACTAGAAATACAAATTTGG - Intronic
996863789 5:128094443-128094465 CAGAGCTAGCATTGGAAATTGGG + Intronic
996891535 5:128427021-128427043 CAAGGTTGGCAATATAAATTTGG - Intronic
997091875 5:130867741-130867763 CAGGTCTAGGAATTCAAACTTGG + Intergenic
998895847 5:146799244-146799266 CTGTGTTAACAATTTAAATTAGG - Intronic
999113420 5:149141542-149141564 CAGGGCTAGCAATGCGAAATAGG - Intronic
1001201720 5:169723721-169723743 CAGGGGTTGCAATTTTAAATAGG - Intronic
1005437126 6:25826161-25826183 AAGGGAAAGCATTTTAAATTAGG - Intronic
1007194925 6:40052147-40052169 CAGGGTTAGCAATTAAAAGATGG + Intergenic
1007224771 6:40305296-40305318 CAGGGCTAGAGATATAAATTTGG + Intergenic
1008249375 6:49220147-49220169 CAGTTCTAGCAAAATAAATTAGG + Intergenic
1011450617 6:87488187-87488209 CTGGGCTAGAGATATAAATTTGG + Intronic
1012384556 6:98664176-98664198 CATTTCTAGAAATTTAAATTAGG + Intergenic
1012474447 6:99604662-99604684 CAGTGCTGGTAATTTAAACTGGG + Intergenic
1012556435 6:100518385-100518407 CAGGGCTAGCTACATAAAATTGG + Intronic
1014028534 6:116675926-116675948 CAGGGATGGAAATTTGAATTTGG + Intergenic
1015003480 6:128249238-128249260 CAGGGTTATCAATTTCAATTGGG - Intronic
1015669611 6:135673481-135673503 CAGGCCTAGCTATTGATATTTGG + Intergenic
1019655778 7:2194279-2194301 CAGGGCTAGCCATTTAATTTTGG - Intronic
1020552493 7:9624672-9624694 CAGGTCTGGGAATATAAATTGGG + Intergenic
1020662302 7:10996319-10996341 TAGGACTAGAAATTTAAATTTGG + Intronic
1024418983 7:49140269-49140291 CAGGGCTAGTAAATAAAAATTGG - Intergenic
1027288589 7:76677159-76677181 CTGGACTAGAAATTTATATTTGG - Intergenic
1027309275 7:76937266-76937288 CAGGGCTGGAGATGTAAATTTGG - Intergenic
1027939076 7:84649658-84649680 CTGGGCTAGAGATATAAATTTGG + Intergenic
1028116659 7:87004863-87004885 CAGGGTTAGCAATTTTCTTTGGG - Intronic
1031690839 7:124785795-124785817 CAAGGCTAAAGATTTAAATTTGG - Intronic
1032311861 7:130794856-130794878 CAGTGCTAGCAGTTTACACTTGG + Intergenic
1032577306 7:133068960-133068982 CAGGGCTAGAGATATAATTTTGG + Intronic
1034324453 7:150217945-150217967 CTGGTGTAGCAATTTACATTTGG - Intergenic
1037954260 8:23041987-23042009 CAGGGCTAGCAGTACACATTTGG - Intronic
1040577238 8:48664318-48664340 CATGTCTAGAAATTTAATTTGGG + Intergenic
1042572250 8:70178273-70178295 AAGGGCCTACAATTTAAATTGGG + Intronic
1043483449 8:80675839-80675861 CAGGGATAGAGATATAAATTTGG + Intronic
1044311660 8:90700310-90700332 CAGGACGAGGAATTTAACTTGGG - Intronic
1045475563 8:102549547-102549569 CTGGGCTAGAGATATAAATTAGG - Intergenic
1046705055 8:117440469-117440491 CAGGGCTAGAAATATAAATCTGG - Intergenic
1047976211 8:130133293-130133315 CAGGGCTAGCATTTTAAAAAAGG + Intronic
1048565204 8:135588797-135588819 CAGAGTTAGAAATTTAGATTTGG - Intronic
1048694372 8:137008670-137008692 CTGGGATAGCAATATGAATTTGG - Intergenic
1050248760 9:3720765-3720787 CATGGTTTGCAATTTAAAATAGG - Intergenic
1052340789 9:27362308-27362330 TAGGGCTAGGATTTTAAACTAGG + Intronic
1052875195 9:33554437-33554459 CAGAGCTGGAAATTTATATTAGG + Intronic
1053500826 9:38589893-38589915 CAGAGCTGGAAATTTATATTAGG - Intergenic
1057680233 9:97174386-97174408 CAGAGCTGGAAATTTATATTAGG - Intergenic
1058881645 9:109290517-109290539 CTGGGATAGCAATTTAAACTAGG - Intronic
1059480203 9:114583412-114583434 CAGGGCTAGGGATTTGAACTCGG + Intergenic
1060776987 9:126381979-126382001 CAGGGCTAACATTTTATTTTTGG + Intronic
1061877799 9:133553682-133553704 CAGGCCTAGGATTTTAAAATAGG - Intronic
1062302862 9:135885263-135885285 CAGGGCCAGAAATGTACATTTGG - Intronic
1203624288 Un_KI270749v1:155713-155735 CAGGCATAGAAATTTAGATTGGG + Intergenic
1186681863 X:11883224-11883246 CTGGGCTACAAATATAAATTGGG + Intergenic
1188340219 X:28990930-28990952 TAGGGACAACAATTTAAATTTGG + Intronic
1188559377 X:31450707-31450729 CAGGGCAAGAAAGTTAAGTTGGG + Intronic
1189111471 X:38294548-38294570 CTGGACTAGAAATATAAATTTGG - Intronic
1189277565 X:39797817-39797839 CAGGGCTAGCTATATAATTTGGG - Intergenic
1191047013 X:56149267-56149289 CAGGGATAGAAATTTAGATTTGG + Intergenic
1192134133 X:68581184-68581206 CAGGGCTAGAGATATAACTTTGG - Intergenic
1192834334 X:74783277-74783299 AAGGGCTAGTATTTTAAATGGGG + Intronic
1195666648 X:107437515-107437537 GAAGGCTAGAAATATAAATTTGG - Intergenic
1195884953 X:109627816-109627838 CAGAGCTAGAGATTCAAATTTGG - Intronic
1196209540 X:112980653-112980675 CTGGGCTAGCGATATAAATTTGG - Intergenic
1197572366 X:128164892-128164914 CAGCTCTAACAATTTACATTTGG - Intergenic
1197783554 X:130179151-130179173 CAGTGCCTGCAGTTTAAATTCGG + Intronic
1197786012 X:130197587-130197609 CTGGGCTAGCAATATGCATTAGG + Intergenic
1199192559 X:144987997-144988019 GAGGGATATCAATTTAAAATTGG - Intergenic
1199456794 X:148038115-148038137 CAGAGCTAGAGATATAAATTTGG + Intergenic
1199516111 X:148677058-148677080 AAATGCTAGCAATTTGAATTAGG + Intronic
1199841559 X:151654369-151654391 CAGGACTGGAAATTTGAATTTGG + Intronic
1201685822 Y:16701439-16701461 CAGGGCTGGAAATATGAATTTGG + Intergenic