ID: 956333260

View in Genome Browser
Species Human (GRCh38)
Location 3:68134778-68134800
Sequence TCCAGGAGGTTACTGTCATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956333260 Original CRISPR TCCAGGAGGTTACTGTCATT GGG Intronic
903415328 1:23178304-23178326 TCCAGGTGTTTTTTGTCATTGGG + Intergenic
904248448 1:29205079-29205101 CCCAGGAGGTTAATGCCCTTAGG + Intronic
905093231 1:35446654-35446676 TCCAGCAGACTACTCTCATTTGG + Intronic
910876099 1:91879601-91879623 TGCATGAGGCTACTGTCATTTGG - Intronic
917689289 1:177450848-177450870 TCAAGGAGTTTACAGTCTTTTGG - Intergenic
921537249 1:216366882-216366904 TACAGCCTGTTACTGTCATTTGG + Intronic
922330923 1:224574836-224574858 TCCAGAATGTTACTGTTACTGGG - Intronic
922654963 1:227373930-227373952 TCCAGGAGATGCTTGTCATTAGG + Intergenic
923096624 1:230780168-230780190 TCCAAAAGGTATCTGTCATTTGG - Exonic
923158058 1:231295759-231295781 GCCAGGAAGTTAATGTCAGTGGG - Intergenic
1068851721 10:61750167-61750189 TTCATGATGTTACTTTCATTAGG + Intronic
1072233599 10:93434016-93434038 TACAGGGGGCTCCTGTCATTGGG - Intronic
1074674895 10:115836928-115836950 TCAAGGAGCCTTCTGTCATTGGG - Intronic
1078630048 11:12994179-12994201 TCCAGGCGGTCACTATCCTTTGG + Intergenic
1081930949 11:46870905-46870927 TTCAGGAGGATACTATTATTAGG + Intronic
1086393226 11:86387700-86387722 CCCAGAAGGTTACTGTCCTGGGG + Intronic
1100373069 12:93987154-93987176 TACATGAGTTTACTGTCAGTGGG + Intergenic
1101112778 12:101502388-101502410 TCCAGCAGGTTACTGGAACTCGG - Intergenic
1102278589 12:111600605-111600627 TCTAGGAGGTTAATTTCAGTTGG - Intergenic
1103561489 12:121795314-121795336 TCCAGGAGGTCACAGTCTTAGGG + Intronic
1105390029 13:19967247-19967269 TTCACGAGTTTACTGTAATTTGG - Intronic
1105541506 13:21320708-21320730 TCCAGGAGCTGAATGTCTTTGGG + Intergenic
1107666735 13:42698328-42698350 TCCTGGAGGTTACTGCCCCTGGG - Intergenic
1108083573 13:46761972-46761994 TCCAGGAGGAGACTGGCATTTGG + Intergenic
1108362429 13:49679419-49679441 TGCAGGATGTTGCTGTAATTGGG + Intronic
1110500780 13:76225180-76225202 TCAAGGAGATCACAGTCATTTGG - Intergenic
1111766314 13:92534460-92534482 TCTAGGAAGTTACTGTTATGAGG - Intronic
1114452249 14:22835105-22835127 TCCAGGAGGTTACCCCCACTGGG + Intergenic
1114595375 14:23907574-23907596 TGCAGGAGGTTAATAACATTTGG - Intergenic
1123466058 15:20516843-20516865 TCCAGGAGGGTCCAGTCTTTTGG + Intergenic
1123652056 15:22484196-22484218 TCCAGGAGGGTCCAGTCTTTTGG - Intergenic
1123742476 15:23293056-23293078 TCCAGGAGGGTCCAGTCTTTTGG - Intergenic
1123760849 15:23431430-23431452 TCCAGGAGGGTCCAGTCTTTTGG + Intergenic
1124276782 15:28332819-28332841 TCCAGGAGGGTCCAGTCTTTTGG + Intergenic
1124305918 15:28578787-28578809 TCCAGGAGGGTCCAGTCTTTTGG - Intergenic
1128569009 15:68719816-68719838 TTCAGAACGTTGCTGTCATTTGG + Intronic
1130410697 15:83645929-83645951 ACCAGGAGGTGACAGTCATTGGG + Intergenic
1130734540 15:86534454-86534476 TCCAGGAGTTTTCTGTGCTTGGG + Intronic
1131102969 15:89708390-89708412 TCCAGGGTGTGACTGTCACTAGG - Intronic
1131408133 15:92183477-92183499 TCCAGGAGACAACTGTGATTTGG + Intergenic
1131771720 15:95745146-95745168 TCCATTAGCTTAGTGTCATTTGG - Intergenic
1132546212 16:534543-534565 TGCAGGAGCTTCCTGTCCTTGGG + Intronic
1133337790 16:5017380-5017402 TCCAGGAGCTTAATGTCCTCAGG + Exonic
1136995857 16:35187732-35187754 TCCAGGATGTCACCGTCAGTGGG + Intergenic
1141890578 16:86924238-86924260 TCCAGGTGGTCACTGCCACTAGG + Intergenic
1142977780 17:3655962-3655984 TCAAGCAGGGTACTGTCCTTAGG - Intronic
1145916985 17:28580038-28580060 CCCAGGAAGGTCCTGTCATTAGG + Exonic
1152994679 18:395576-395598 TCCAAGAGGGTACTGTACTTGGG + Intronic
1157073504 18:44438073-44438095 TCCAGGAGGACACAGTCATGGGG - Intergenic
1157104987 18:44765625-44765647 GGGATGAGGTTACTGTCATTGGG - Intronic
1158790542 18:60775074-60775096 TTCTTGAGGTTTCTGTCATTTGG - Intergenic
1165394442 19:35556726-35556748 TCCAGGAGCTCAGTGTCATTAGG - Intronic
925137776 2:1532423-1532445 TGCAGGAGGTTACTCACAGTGGG - Intronic
927643544 2:24860738-24860760 TCTGGGAGTTGACTGTCATTAGG + Intronic
929317799 2:40501287-40501309 TCCAGGGTGTTAATGTCACTGGG - Intronic
932645314 2:73494303-73494325 ACCAGGAGGTAGATGTCATTGGG + Intronic
932850786 2:75182982-75183004 TTCAGGAGCTTACAGTCAATTGG - Intronic
935684304 2:105670006-105670028 TCCAGTTGGTTTCTGTCAATGGG - Intergenic
935894538 2:107720280-107720302 TCAAGGAGTTTACAGTCAATTGG - Intergenic
937471967 2:122181832-122181854 TCCATGAGATTAGTGCCATTGGG - Intergenic
940026136 2:149210445-149210467 TCCAGGTGGTTAGTATCTTTGGG - Intronic
942159761 2:173171531-173171553 TCCAAGAGTTTACTCTCAGTAGG + Intronic
942500236 2:176581639-176581661 ATCAGGAGGCTACTGACATTAGG - Intergenic
944580667 2:201129968-201129990 TCCAGAAGGTCCCTGACATTAGG - Exonic
945378952 2:209116043-209116065 TCCAGCAGGTTACCTTCCTTAGG + Intergenic
945795801 2:214362051-214362073 TCCTGTAGGTTACTGAAATTTGG - Intronic
946574556 2:221060353-221060375 TCCTGGAGGTTACTGCCATTTGG + Intergenic
948733915 2:239986226-239986248 TCCTGCAGGTTATTTTCATTGGG - Intronic
1170827836 20:19811392-19811414 GCCAGGAAGTTACTGCCTTTTGG - Intergenic
1171119517 20:22556532-22556554 TCCAGGAGGGTACTGTGGTCTGG + Intergenic
1172191612 20:33065097-33065119 TCCAGGAGGTCACTTTCAATTGG + Intronic
1175248365 20:57594645-57594667 TCCAGGTGGTTGCTTTCTTTTGG - Intergenic
1175368144 20:58469529-58469551 TCCAGAATGTTACTGTCTTGGGG + Intronic
1175417117 20:58809106-58809128 GCCAGGGTGTAACTGTCATTTGG - Intergenic
1178611135 21:34081619-34081641 TCCAGAAGGTTAAAGTCCTTAGG - Intronic
1180715656 22:17870437-17870459 TCCAGGAGCTCACTGTCCTATGG - Intronic
1183294930 22:37023951-37023973 TCCGGGAGGTCATGGTCATTGGG + Intronic
1183391476 22:37547679-37547701 TCACGGAGGTTAATGTCATGGGG + Intergenic
949509071 3:4752900-4752922 TCCAGGAGCTTACAGTCTTGTGG + Intronic
953993049 3:47498589-47498611 TCCAGTAGGTGACTGGAATTAGG - Intronic
955783353 3:62509614-62509636 TCTAGAAGGTTTCTGTCAATTGG + Intronic
956333260 3:68134778-68134800 TCCAGGAGGTTACTGTCATTGGG + Intronic
968568065 4:1325469-1325491 TCTAGTAGGTTACTTTCAATTGG - Intronic
980082674 4:128360877-128360899 TCAAGGAGCTTACTGTTAGTAGG - Intergenic
981024320 4:140061318-140061340 GTTAGGAGGTTACTTTCATTAGG - Intronic
984254352 4:177373179-177373201 TCAAGGAGTTTACAGTCTTTGGG + Intergenic
986201929 5:5586944-5586966 TCCAGCAGGTTGGTGTCATGTGG + Intergenic
996294909 5:121901169-121901191 TCAAGTAAGTTAATGTCATTGGG - Intergenic
999588882 5:153122016-153122038 TGCTGGAGGTTCCTGTGATTAGG - Intergenic
1007945532 6:45823509-45823531 TCCAGGAGTTTAGTAGCATTAGG - Intergenic
1008824636 6:55678697-55678719 TCCAGTTTGTTACTATCATTTGG + Intergenic
1008872081 6:56284539-56284561 TCCAGGAGAATAATGACATTGGG - Intronic
1016541171 6:145166843-145166865 TCCAGGTGTTCAATGTCATTTGG + Intergenic
1017645087 6:156533013-156533035 TCAAGGAGTTTACTGTCTATTGG + Intergenic
1018943924 6:168332080-168332102 TGGTGGTGGTTACTGTCATTTGG + Intergenic
1021195307 7:17667685-17667707 TCCATGAGGTTTCTATCATTTGG + Intergenic
1021539651 7:21743051-21743073 TTTAGGAGGTGACTGTCATGAGG - Intronic
1026026243 7:66746254-66746276 TCAATGAAGTTACTGTCAGTGGG + Intronic
1033241534 7:139683622-139683644 ACCAGGAGGTGAGGGTCATTAGG + Intronic
1033811342 7:145015646-145015668 ACCAGGATCTTACTGTTATTTGG - Intergenic
1034866417 7:154646180-154646202 TCCAGGAAGTCATTGTCAATTGG - Intronic
1034905574 7:154941913-154941935 TCTAGGAGTTTAGTCTCATTAGG - Intronic
1035040552 7:155923783-155923805 TCCTGGAGATGAGTGTCATTGGG + Intergenic
1036538642 8:9679343-9679365 TCCAAGAGGTTCATGGCATTTGG + Intronic
1038357914 8:26847452-26847474 TTCATGAGTTTGCTGTCATTTGG - Intronic
1039727749 8:40238201-40238223 TCTAGGATGGAACTGTCATTAGG - Intergenic
1040604957 8:48922194-48922216 GGCAAGAGGTAACTGTCATTTGG + Intergenic
1051808766 9:21027023-21027045 TCTAGGAGGTTACTCTTATGTGG - Intronic
1052037641 9:23701155-23701177 TGCTGTAGGTTACTGTCCTTTGG + Intronic
1055091529 9:72368385-72368407 TCATGGATCTTACTGTCATTTGG + Intergenic
1056939465 9:90942655-90942677 GCCAGGCGGTTACTGTGGTTTGG + Intergenic
1057634979 9:96756382-96756404 TCATAGAGGTTACTGTAATTGGG - Exonic
1058172399 9:101698440-101698462 ACGATGAGGGTACTGTCATTAGG + Intronic
1058533379 9:105929575-105929597 TCCTGGAGGTTATTCTCATTGGG + Intergenic
1059808843 9:117833790-117833812 TCCTGGAGGTTAGTTGCATTGGG + Intergenic
1187335682 X:18379338-18379360 TCCAGGAGGTTACTTACATGTGG + Intergenic
1190977231 X:55417280-55417302 TCCATGAGGTTGCTGACCTTTGG - Intergenic
1190979307 X:55441844-55441866 TCTAGGTGGTCACTGTCATTTGG - Intergenic
1190989063 X:55527088-55527110 TCTAGGTGGTCACTGTCATTTGG + Intergenic
1191889245 X:65924510-65924532 TCTATGAGGTTGCTGTCTTTTGG + Intergenic
1199538127 X:148926719-148926741 GCCAGGAGGTTATTGCAATTTGG - Intronic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic