ID: 956334329

View in Genome Browser
Species Human (GRCh38)
Location 3:68146357-68146379
Sequence GCACCTCTTAAGGAGAAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 201}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956334329 Original CRISPR GCACCTCTTAAGGAGAAAGA CGG (reversed) Intronic
900975367 1:6013015-6013037 GCTCCTCTTAGGGCGACAGAGGG - Intronic
901954656 1:12775402-12775424 GCAGGTTTCAAGGAGAAAGAGGG + Intronic
904325353 1:29724374-29724396 CCACCTCAGGAGGAGAAAGAAGG + Intergenic
905787857 1:40772203-40772225 GCATCTCTCATGGAGAAAGCTGG + Intergenic
906676217 1:47695398-47695420 GGGAGTCTTAAGGAGAAAGAAGG + Intergenic
913066207 1:115257729-115257751 CCACATCTTAAGGAGTAGGAGGG + Intergenic
913996193 1:143653458-143653480 GCTCCTCTTTTGGAGAAAGGAGG - Intergenic
914376625 1:147078464-147078486 GCTCCTCTTTTGGAGAAAGGAGG + Intergenic
914492750 1:148162407-148162429 GCTCCTCTTTTGGAGAAAGGAGG - Intergenic
916607856 1:166360747-166360769 GGATGGCTTAAGGAGAAAGAGGG + Intergenic
916843561 1:168625544-168625566 GAATCTGTTAAAGAGAAAGAAGG - Intergenic
918516123 1:185365723-185365745 TCACCTCTGTAGGAGAGAGAGGG + Intergenic
924715430 1:246568539-246568561 ACACTTCTTAAGAAAAAAGATGG - Intronic
1064551780 10:16508533-16508555 GCATCTGTGAAGGAGATAGAAGG + Intronic
1071687215 10:87771942-87771964 AAACCTCTTAGGGAGAAATAAGG - Intronic
1074331605 10:112517212-112517234 GAATCTGTTAAGGAGAAAGTGGG + Intronic
1075794925 10:125113120-125113142 ACACCTCTTAAGGAAGTAGATGG + Intronic
1075939067 10:126372807-126372829 GCAGCACTGAGGGAGAAAGAAGG + Intronic
1077865940 11:6222011-6222033 GCAAATCCAAAGGAGAAAGAAGG + Intronic
1078467685 11:11562323-11562345 GCACATCTAAAGGGGAAACATGG - Intronic
1078538514 11:12194610-12194632 ACATTTCTTTAGGAGAAAGAGGG - Intronic
1078667117 11:13334941-13334963 GCAACTCACAAAGAGAAAGATGG - Intronic
1078739625 11:14054381-14054403 CCAGTTCTTAAGGAGAAAGAGGG + Intronic
1080812120 11:35715249-35715271 GCACCCCTTAACGTGAGAGATGG - Intronic
1080951717 11:37041455-37041477 GCACTACTTAAAGAGACAGAAGG - Intergenic
1082149960 11:48726328-48726350 TCACATAATAAGGAGAAAGAAGG + Intergenic
1082598907 11:55124069-55124091 TCACATAATAAGGAGAAAGAAGG + Intergenic
1084181054 11:67446214-67446236 GCACCTATGAAGGAGAGGGAAGG + Intergenic
1085646525 11:78227046-78227068 GCACTCCTAAAAGAGAAAGAAGG + Exonic
1088070151 11:105773225-105773247 CTCCCTCTTAAGGACAAAGAAGG - Intronic
1088402802 11:109439916-109439938 GCACCTCTCCAGGACACAGAAGG + Intergenic
1090111160 11:123910891-123910913 CCGCCTCTTAAGCAGAAGGAAGG - Intergenic
1090287216 11:125510326-125510348 GCACTTCCTAAGGGAAAAGAGGG + Intergenic
1093880242 12:24395936-24395958 GCACTTCTTAGAGATAAAGAGGG - Intergenic
1094092329 12:26663806-26663828 GCACCCTTTAAAGAGAAAGCAGG - Exonic
1094194823 12:27737520-27737542 GCACCTATTAAAGAGAAAGCGGG - Exonic
1096335501 12:50752212-50752234 GCACGTAGGAAGGAGAAAGAGGG + Intergenic
1096983120 12:55740090-55740112 ACACATTTTAGGGAGAAAGAAGG + Intergenic
1098464907 12:70775639-70775661 GCATCTCTTAGGAAGAAAGATGG - Intronic
1100150954 12:91736976-91736998 GCATCTCATAAGGGGAATGACGG - Intergenic
1100590933 12:96028457-96028479 CCACCTCTTGAGGGGAAAGAGGG - Intronic
1100702987 12:97167568-97167590 GCAGCTGTTAATGAGAATGAAGG + Intergenic
1102446133 12:113004192-113004214 CCACCTCTTAAAGACAAAGGTGG + Intronic
1102894409 12:116587251-116587273 GCACCTATAAAGGAGAAAAGAGG + Intergenic
1105433668 13:20359551-20359573 GCTCCACTCATGGAGAAAGAAGG - Intergenic
1107676447 13:42802695-42802717 GCATGTGTTTAGGAGAAAGAGGG - Intergenic
1109073535 13:57803398-57803420 GCTCCTGTTAAGCAGAAACACGG + Intergenic
1112463823 13:99625838-99625860 GCAGCTCCTAAGAAGAGAGAAGG + Intronic
1115789033 14:36858126-36858148 GGACCTCCTAGGGAAAAAGAGGG - Intronic
1115941469 14:38615261-38615283 TCACCTCTTGAGCAGAAAGAGGG - Intergenic
1121667000 14:95680174-95680196 GCACCTCTGAAGGAGGAAGCTGG - Intergenic
1122495700 14:102153162-102153184 GCACTTCACATGGAGAAAGAAGG - Intronic
1124034218 15:26039108-26039130 GGACATCTTTAGGAGAAACATGG + Intergenic
1124058057 15:26260775-26260797 TCACCTCCTACGGAGAAAGAGGG + Intergenic
1124102539 15:26709364-26709386 GCATGTCCTATGGAGAAAGAGGG - Intronic
1124865347 15:33485321-33485343 GCATCTCTGAAAGAGAATGATGG + Intronic
1126859039 15:52866249-52866271 GTACCCTTTAGGGAGAAAGAAGG - Intergenic
1129208263 15:74050228-74050250 GCTCCTCTGTAGGAGGAAGATGG - Intergenic
1130315996 15:82797474-82797496 GCATCTCTTAATGAGGTAGATGG - Intronic
1130974049 15:88759154-88759176 GCACAACTCTAGGAGAAAGAAGG + Intergenic
1131803137 15:96093181-96093203 CCACCTATTAAGGAAAAAAATGG + Intergenic
1131807194 15:96135267-96135289 GCACATCTTTAGGAGATAGCTGG - Intergenic
1132329368 15:101001006-101001028 CAAGCTCTTAAGGAGAAAGGAGG - Intronic
1137632177 16:49954640-49954662 GCAACTCTAAAAAAGAAAGAAGG + Intergenic
1138073987 16:54022345-54022367 CCAGCTCTGAAGAAGAAAGATGG + Intronic
1138434998 16:56993309-56993331 GCAGCTGTTAAAAAGAAAGAGGG - Intronic
1139149610 16:64365821-64365843 GCACCATTTAGGGAGAAACATGG - Intergenic
1139922150 16:70467253-70467275 GCACCTCTAAAAGGGAAATACGG - Intronic
1140653115 16:77110006-77110028 GCACCGCTGGAGGAGATAGAAGG - Intergenic
1142106153 16:88303960-88303982 GCACCTCTTCAAGAGGAAGCAGG - Intergenic
1143983607 17:10892130-10892152 AAATCTCTTAAGTAGAAAGAGGG - Intergenic
1145012750 17:19378907-19378929 GAGCCTCTGAAGGAGGAAGACGG + Exonic
1145395816 17:22493755-22493777 GCTTCTCTTAATGAGACAGATGG + Intergenic
1149612472 17:57967641-57967663 GCACCTCTGAGGGAGAAGAATGG - Intergenic
1150371864 17:64645778-64645800 GCATCTCTTAATGAGATGGATGG + Intronic
1150477008 17:65483378-65483400 GGACCTCTAAAGAAGGAAGATGG - Intergenic
1150969753 17:70014193-70014215 GCAGTTCAAAAGGAGAAAGAAGG + Intergenic
1151285030 17:73104658-73104680 GGTCCTTATAAGGAGAAAGAGGG + Intergenic
1152284022 17:79402130-79402152 GCACCACTCAAGGAGAAAAGGGG + Intronic
1153161779 18:2213986-2214008 GAAGCTCAGAAGGAGAAAGAGGG + Intergenic
1153740160 18:8116908-8116930 GAACCTCTTTTGGGGAAAGAGGG + Intronic
1157571135 18:48713154-48713176 GCACCCCTCAAGGAGGAATAGGG + Intronic
1160571450 18:79820024-79820046 GCACCTCCTTCGGAGAAGGAAGG - Intergenic
1161369334 19:3901591-3901613 GCACGGCTTGAGGAGAATGAAGG - Intronic
1161633937 19:5375253-5375275 GCAGCTGTTAAAAAGAAAGAGGG + Intergenic
1164433364 19:28207591-28207613 GCCCCTCTTGGGGAGAAAGCGGG - Intergenic
1165094129 19:33401403-33401425 ACACCGCTTAAGGACAAAGCAGG + Intronic
1165457203 19:35919676-35919698 ACACCTCTGAAGGAGGCAGAGGG + Intergenic
1166023524 19:40055832-40055854 GCAGCTTTGAAGGGGAAAGACGG + Intronic
925101994 2:1255033-1255055 GCACCTCTTATGTTAAAAGAGGG - Intronic
925391191 2:3495309-3495331 GCACTTCTAAAGGTGAAACAGGG - Intergenic
925501086 2:4505635-4505657 CCACATTTTAAGCAGAAAGAAGG - Intergenic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
927424961 2:22971228-22971250 GCTCTTCTCAAGCAGAAAGAAGG - Intergenic
927896896 2:26788566-26788588 GCTCCTCTGTAGGTGAAAGAAGG - Intronic
936638516 2:114286533-114286555 GCACCTCATACGGCGAAAGCAGG + Intergenic
939181174 2:138804057-138804079 GCATCTGGTAGGGAGAAAGATGG + Intergenic
941956425 2:171210217-171210239 GCCCCTCTGAAAGAGAAATAAGG + Intronic
941986909 2:171519424-171519446 AGACCTCATAGGGAGAAAGATGG - Intergenic
942543575 2:177039467-177039489 GGACTTCTTAGGAAGAAAGATGG + Intergenic
944185335 2:196941909-196941931 ACCCCTCTGTAGGAGAAAGAAGG + Intergenic
948612467 2:239178711-239178733 GCTCCCCTTATGGAGGAAGAGGG + Intronic
1168919095 20:1516093-1516115 GCTCCTCCTAAGGACACAGATGG + Intergenic
1169041550 20:2499532-2499554 GCTCCTCTGAAGGAAAAATAAGG - Intronic
1169839765 20:9922525-9922547 GCATCTCTTAATGAGATAAATGG + Intergenic
1169856846 20:10112405-10112427 GAGCATCTTCAGGAGAAAGATGG - Intergenic
1170372739 20:15667258-15667280 GCACATCATATGGAGAAAGCAGG - Intronic
1170446892 20:16437618-16437640 ACTCCTCTTAATGAGAAATACGG + Intronic
1170675218 20:18472850-18472872 GGATCTCTTAAGGAGCAATACGG + Exonic
1170770064 20:19325117-19325139 TCACCTCCTTAGGAGAGAGAAGG + Intronic
1172926626 20:38542899-38542921 GCATGTCTTAAAGAGTAAGAAGG + Intronic
1173224087 20:41151823-41151845 GCAGCTCTGAAGGAAAAGGATGG - Intronic
1174658852 20:52193105-52193127 ACACCTTTTAAGGACAAAGCAGG - Intronic
1174702458 20:52622694-52622716 ACTCCTCTTCAGGAGAAGGAAGG + Intergenic
1178037107 21:28597319-28597341 GCATCTGTTAAGGAGAGAGGTGG + Intergenic
1178198974 21:30380741-30380763 ACACCTCTAAAGGAGAAGTATGG - Intronic
1179135329 21:38675489-38675511 CCACATCTTTATGAGAAAGAGGG + Intergenic
1179207694 21:39298852-39298874 GCACCTCTGAAAAAGAAAAAAGG + Intronic
1179316043 21:40245301-40245323 GGACCTCTTTAGGACAAAAAGGG + Intronic
1181621871 22:24096674-24096696 GCAAGTCCTAGGGAGAAAGATGG + Intronic
1183213556 22:36465424-36465446 GCACCTTTTAAGGAGGGAGCTGG + Intergenic
1183516543 22:38270182-38270204 CCACCTATGAAGGAGAAGGAGGG - Intronic
1184617983 22:45651043-45651065 TCAGATCTTGAGGAGAAAGAAGG - Intergenic
949933897 3:9101732-9101754 GCCCCTCTTTAAGAGAAAAAGGG - Intronic
950214098 3:11145744-11145766 GTACCTCTGGAGGAGAAGGAGGG - Intronic
954575573 3:51674252-51674274 GCAGCTGCAAAGGAGAAAGAAGG - Exonic
956334329 3:68146357-68146379 GCACCTCTTAAGGAGAAAGACGG - Intronic
956521639 3:70110544-70110566 GCAGCTCTGAAAGAGAAATAGGG - Intergenic
956840529 3:73135741-73135763 CCATCTCTTAAAAAGAAAGAAGG + Intergenic
957295521 3:78328232-78328254 GTATCTCCTAAAGAGAAAGATGG - Intergenic
957829779 3:85502380-85502402 GCTACTCTTAAGGAGGAAAAAGG + Intronic
958869937 3:99545953-99545975 GCACCTCTAAAGGAGAATGCTGG + Intergenic
959162277 3:102737182-102737204 GCAGCCCTCAAGGAGACAGAAGG + Intergenic
959873110 3:111350857-111350879 GCCCCTCTTAATGAAAGAGAAGG - Intronic
960959426 3:123059009-123059031 TGAACTCTTAAGGACAAAGATGG - Intergenic
961084208 3:124052580-124052602 GCATCTCAAAAGGAGAAATAGGG + Intergenic
963097474 3:141560240-141560262 ACGACTCTTAAGGAGAAAAATGG + Intronic
963757693 3:149252907-149252929 TCACTTCTTTAGGAGCAAGAAGG - Intergenic
964517670 3:157530539-157530561 GCAACTCACAAGGAGAGAGAAGG + Intronic
967751010 3:193116316-193116338 GAACATCTTAAGGAAAAGGAAGG - Intergenic
967969980 3:194991650-194991672 GCACTTCTTAATGAGATAAATGG + Intergenic
968076008 3:195816451-195816473 GCACCTGGTAAGGAGAAGGGCGG - Intergenic
968076020 3:195816499-195816521 GCACCTTGTAAGGAGAAGGGCGG - Intergenic
968076031 3:195816547-195816569 GCACCTGGTAAGGAGAACGGCGG - Intergenic
968076044 3:195816595-195816617 GCACCTCGTAAGGAGAAGGGCGG - Intergenic
968076057 3:195816643-195816665 GCACCTCGTAAGGAGAAGGGCGG - Intergenic
968076070 3:195816691-195816713 GCACCTGGTAAGGAGAAGGGCGG - Intergenic
968076082 3:195816739-195816761 GCACCTGGTAAGGAGAAGGGCGG - Intergenic
968162850 3:196441111-196441133 GGTGCTTTTAAGGAGAAAGAAGG + Intergenic
968841036 4:3005975-3005997 ACACCTGGTTAGGAGAAAGATGG - Intronic
969656495 4:8501709-8501731 GCTCCCCATAAGAAGAAAGAAGG - Intergenic
971355380 4:25890493-25890515 GCACCTCTGAAGGAAACAGGAGG + Intronic
976610050 4:87021094-87021116 GCACCTCAGAAGGGTAAAGAAGG - Intronic
979834021 4:125339042-125339064 GAAGCTCTTAAGGACAGAGATGG - Intronic
982806897 4:159777306-159777328 GCAGCTCATTAGGAGAAAGAGGG - Intergenic
983299557 4:165908286-165908308 GCACCCCTTAAATAGAAGGATGG + Intronic
986829442 5:11559734-11559756 CCCCCACTGAAGGAGAAAGATGG - Intronic
991479466 5:67061707-67061729 GAACTTGTTAAGCAGAAAGAGGG - Intronic
994490246 5:100433235-100433257 GCACCTCTCTAGAAGAAAGTTGG - Intergenic
995006742 5:107206110-107206132 ACACTTCCTAAGGAGAAGGATGG - Intergenic
995115213 5:108471470-108471492 GCAACTCTGGAAGAGAAAGAAGG - Intergenic
996216428 5:120872138-120872160 GCACATCTTATGGTGAAAGCAGG - Intergenic
996483186 5:123998833-123998855 GCACCCTTTAAGAAGGAAGATGG + Intergenic
998881957 5:146653930-146653952 TCCCCTCACAAGGAGAAAGAGGG + Intronic
998983805 5:147733078-147733100 GAAATTCTTAAGGAGAGAGATGG + Intronic
999828577 5:155297836-155297858 GCGTCTCTTAAGGAGAAAGCTGG - Intergenic
999870848 5:155749165-155749187 TTACCTCTTAAGGAGTAACAAGG - Intergenic
1000191745 5:158917798-158917820 GCATCCCTTGAGGAAAAAGAGGG - Intronic
1000458325 5:161480886-161480908 GCATATCTTAAGGAAAATGATGG + Intronic
1001138254 5:169120851-169120873 TCACCTCTAAAGCAGGAAGAAGG - Intronic
1003914552 6:10774348-10774370 ACATCTCTTAATGAGAAAGGTGG + Intronic
1004536927 6:16511991-16512013 GGACCGTTTGAGGAGAAAGATGG - Intronic
1006605758 6:35256520-35256542 GCATCTGTTAATGAGAAATATGG - Intergenic
1006747077 6:36350570-36350592 CCACCTCTGAGGGAGAAAAAGGG - Intergenic
1008203579 6:48624377-48624399 GCAAGTCTGTAGGAGAAAGAAGG + Intergenic
1010173941 6:73004430-73004452 GCACCTCATAAGAAAATAGAAGG + Intronic
1012350688 6:98246353-98246375 GCACCACTTTAGTAGAAAGAAGG - Intergenic
1013298523 6:108781314-108781336 GCACATCTTAGGAAGGAAGAGGG + Intergenic
1017383641 6:153858242-153858264 CCAAATCTGAAGGAGAAAGAAGG + Intergenic
1018850822 6:167589084-167589106 GCTCCTCTGAAGGAGGAGGATGG - Intergenic
1019515231 7:1436943-1436965 GCTCCTCTTTTGGAGGAAGAAGG + Intronic
1019567768 7:1693097-1693119 GCACCCCTTAAGGAGGGTGAAGG - Exonic
1019947763 7:4343538-4343560 GCAGCTCTTAACAAGGAAGAGGG + Intergenic
1023064937 7:36367541-36367563 GCACCTCGTAAGGGGAAGGACGG - Intronic
1024185014 7:46940697-46940719 GCATGGCTAAAGGAGAAAGAGGG - Intergenic
1029065621 7:97844956-97844978 GCACTTCTTACATAGAAAGAAGG + Intergenic
1030257711 7:107529568-107529590 TCACCTCTTAAGGGTAAGGAGGG + Intronic
1030572120 7:111240107-111240129 GCAGCTCTTAAGGAAACAAAGGG + Intronic
1032018636 7:128394655-128394677 CCACCTCTTAAGGGCAAAAACGG + Intronic
1032558922 7:132867571-132867593 GGACGTTTTAAGGAGAGAGAAGG - Intronic
1034392038 7:150794356-150794378 GGACCTCTGAAGGAGAATGGGGG - Intronic
1034933859 7:155185680-155185702 GCAGCTTTTCAGGAGACAGATGG - Intergenic
1036638899 8:10569821-10569843 GCATCTCCTATGGAGAATGAGGG - Intergenic
1036697010 8:10981794-10981816 GCACCTCCACTGGAGAAAGAAGG - Intronic
1036930095 8:12947950-12947972 ACACCTCTTAAGGCTACAGATGG - Intronic
1037043973 8:14274349-14274371 GCACTTATTAAGGAGACAGTTGG + Intronic
1037448887 8:18997017-18997039 GCACCAATAAAGGAGAATGAAGG - Intronic
1037532342 8:19790242-19790264 ACCCCTCTTAAGGAGAAGGTGGG + Intergenic
1039860418 8:41452811-41452833 GCACCCCTAAAGGAGATGGATGG + Intergenic
1040275544 8:46011938-46011960 GCACCTCTAAAGGAAGAAGAAGG - Intergenic
1041164593 8:55078876-55078898 ACAACTCTTAAGGATGAAGAAGG + Intergenic
1043373537 8:79621532-79621554 GCTCTTCTTTAGGAGGAAGAAGG - Intronic
1044250853 8:90002177-90002199 CCACCCCTTAAGGAGTGAGAGGG + Intronic
1045702596 8:104884098-104884120 GAACCTCTGAAGGAGCAAAAGGG - Intronic
1046693373 8:117310958-117310980 GTACCTGTTTAGGATAAAGATGG - Intergenic
1048406544 8:134128316-134128338 GCCCCAATTAAGGAGAGAGAAGG - Intergenic
1049195013 8:141310612-141310634 GCACTCCTTAAGAAGAGAGATGG - Intergenic
1049562357 8:143318081-143318103 GTACACCTGAAGGAGAAAGAAGG + Exonic
1051306670 9:15717576-15717598 TCACCTCTTAAGCAGAAAGAAGG - Intronic
1051617865 9:19023762-19023784 GCATTTCTGAAGAAGAAAGAAGG + Intronic
1052922911 9:33986903-33986925 GCACCTATTAAAGGCAAAGAAGG + Intronic
1056180309 9:84076400-84076422 CCACCCCTTAAGCAGAAGGAAGG - Intergenic
1193661008 X:84258354-84258376 GCACTTATGAAGGAGAATGAGGG + Intergenic
1195220458 X:102741354-102741376 TCACTTCCTAAGGAGAAGGAGGG - Intronic
1196698079 X:118635215-118635237 GAACCTCTCAATGATAAAGATGG - Intronic
1198861170 X:141072201-141072223 GGTTCTCTTAAGAAGAAAGAAGG + Intergenic
1198901522 X:141515182-141515204 GGTTCTCTTAAGAAGAAAGAAGG - Intergenic
1200388974 X:155923958-155923980 GCACATGTTAAGGAGACACATGG - Intronic