ID: 956339709

View in Genome Browser
Species Human (GRCh38)
Location 3:68208760-68208782
Sequence TGGAGGAAATTCTGCACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 203}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956339709_956339716 4 Left 956339709 3:68208760-68208782 CCTGCTGTGCAGAATTTCCTCCA 0: 1
1: 0
2: 2
3: 19
4: 203
Right 956339716 3:68208787-68208809 GTATGCTTGGGTGGTAGGCATGG 0: 1
1: 0
2: 0
3: 11
4: 158
956339709_956339710 -9 Left 956339709 3:68208760-68208782 CCTGCTGTGCAGAATTTCCTCCA 0: 1
1: 0
2: 2
3: 19
4: 203
Right 956339710 3:68208774-68208796 TTTCCTCCAAGTTGTATGCTTGG 0: 1
1: 0
2: 1
3: 22
4: 200
956339709_956339715 -1 Left 956339709 3:68208760-68208782 CCTGCTGTGCAGAATTTCCTCCA 0: 1
1: 0
2: 2
3: 19
4: 203
Right 956339715 3:68208782-68208804 AAGTTGTATGCTTGGGTGGTAGG 0: 1
1: 0
2: 0
3: 5
4: 157
956339709_956339711 -8 Left 956339709 3:68208760-68208782 CCTGCTGTGCAGAATTTCCTCCA 0: 1
1: 0
2: 2
3: 19
4: 203
Right 956339711 3:68208775-68208797 TTCCTCCAAGTTGTATGCTTGGG 0: 1
1: 0
2: 1
3: 11
4: 167
956339709_956339717 23 Left 956339709 3:68208760-68208782 CCTGCTGTGCAGAATTTCCTCCA 0: 1
1: 0
2: 2
3: 19
4: 203
Right 956339717 3:68208806-68208828 ATGGATCTAAGATGCCCCCAAGG 0: 1
1: 0
2: 0
3: 6
4: 107
956339709_956339713 -5 Left 956339709 3:68208760-68208782 CCTGCTGTGCAGAATTTCCTCCA 0: 1
1: 0
2: 2
3: 19
4: 203
Right 956339713 3:68208778-68208800 CTCCAAGTTGTATGCTTGGGTGG 0: 1
1: 0
2: 0
3: 8
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956339709 Original CRISPR TGGAGGAAATTCTGCACAGC AGG (reversed) Intronic
901245465 1:7726925-7726947 GGGAGAAAATTCTGCACAGAAGG - Intronic
902683882 1:18063029-18063051 TTGAGCACATTCTGCACACCAGG + Intergenic
903282717 1:22259143-22259165 TGGAGGAGACTTAGCACAGCGGG - Intergenic
904271304 1:29351993-29352015 TGGAGAATATGCTGCACACCAGG + Intergenic
905177102 1:36143919-36143941 TGGAGCACCTGCTGCACAGCAGG + Intronic
905397739 1:37677867-37677889 TGGAGGTAGCTCTGCACTGCAGG + Intergenic
906074336 1:43041105-43041127 TGGGGGAAATGCTTCACACCAGG + Intergenic
906898959 1:49812332-49812354 TGGAGGAAATCATGCTCAGAGGG - Intronic
908387307 1:63654574-63654596 TGGAAGAAAGTAAGCACAGCTGG - Intronic
908596266 1:65691871-65691893 TGGAGGAAGCTCTGGAAAGCTGG - Intergenic
908679340 1:66642190-66642212 TGGAGAAGAAGCTGCACAGCGGG - Intronic
911047292 1:93639119-93639141 TGGAGGAAAATATGCATGGCTGG - Intronic
913657148 1:120972039-120972061 TTGAGGAAATTATGCAAAGCAGG - Intergenic
914008491 1:143755123-143755145 TTGAGGAAATTATGCAAAGCAGG - Intergenic
914521710 1:148423293-148423315 TTGAGGAAATTATGCAAAGCAGG - Intergenic
914647121 1:149663774-149663796 TTGAGGAAATTATGCAAAGCAGG - Intergenic
915370572 1:155346287-155346309 TAAAGGAAATTCTGCAAAGCAGG + Intronic
915740609 1:158115896-158115918 TGGAGGAGATTCAGCACAGGAGG - Intergenic
916727995 1:167540451-167540473 TGGAGTAAATGCAGCTCAGCAGG - Intronic
917534004 1:175861473-175861495 AGGATGAAATTCTTCACAACGGG - Intergenic
917962730 1:180157305-180157327 TGGAGGACATTCTTCATTGCAGG - Intronic
919213554 1:194520360-194520382 TGGAGTAACTTTTGCACATCAGG + Intergenic
919728694 1:200899695-200899717 TTGAGGGAATTCTGGACATCAGG + Intronic
920811710 1:209292003-209292025 AACAGGAAATTCAGCACAGCAGG + Intergenic
924292494 1:242551519-242551541 TGGAAGAGATTTTGCACAGTTGG + Intergenic
924590850 1:245402939-245402961 TGGAGTGAATTCTAGACAGCTGG + Intronic
1063264630 10:4434337-4434359 TGGAGGTAAAACTGCTCAGCAGG - Intergenic
1063756086 10:9010348-9010370 TGGTGGTACTGCTGCACAGCAGG - Intergenic
1064708950 10:18103363-18103385 TTGGGGAAATTCTGCACACTTGG - Intergenic
1064916800 10:20467269-20467291 TCAATGAAATTCTACACAGCGGG - Intergenic
1065089396 10:22215852-22215874 TGGATGAAATATTACACAGCAGG + Intergenic
1066510316 10:36088194-36088216 TGCAGGTGATTCTGGACAGCAGG + Intergenic
1068752785 10:60614631-60614653 TGAAGGATATTCTGCTCAGTGGG - Intronic
1068786617 10:60982639-60982661 AGGAGGAAATTTTGCCCATCAGG - Intronic
1069332753 10:67312482-67312504 TTGAGAAAATTCTACACAGAGGG + Intronic
1071918582 10:90324574-90324596 TGGAGGAATTGCTGCCAAGCAGG - Intergenic
1072342669 10:94469863-94469885 TGGAGGCAATACTGAACATCAGG - Intronic
1072865644 10:99058160-99058182 TGGGAGAGATTCTCCACAGCTGG + Intronic
1072970192 10:100010233-100010255 TGGAGGAACTTGTCCGCAGCCGG - Intergenic
1073514855 10:104067131-104067153 TTTAGGAATTTCTGCTCAGCTGG - Intronic
1073720224 10:106160471-106160493 TAGAGAAAATTCTGCTCATCTGG + Intergenic
1078388295 11:10912435-10912457 TGAAGGAGCTTCTGCACCGCCGG - Intergenic
1079319938 11:19443269-19443291 TGGATGAAATGCTACACTGCAGG + Intronic
1085672989 11:78486321-78486343 TGAAGGAAATTCTGAAGAACAGG + Intronic
1085859652 11:80216786-80216808 TGGAGGAAATTCATCACCACTGG + Intergenic
1087345705 11:96968458-96968480 TGGAGGAATTTATGCTGAGCTGG + Intergenic
1087357491 11:97113010-97113032 TTGAGAAAATACTGCACAGAGGG - Intergenic
1089394997 11:118130959-118130981 TGCAGGAAAATCTGCAGAGGGGG - Intergenic
1090208685 11:124900018-124900040 TGGAGGATTTACTGCACAGGAGG + Intergenic
1091760677 12:3085262-3085284 TGGGGGACATGCCGCACAGCAGG - Intronic
1092523576 12:9295922-9295944 TGGAGGAAGTTCAGGGCAGCGGG - Intergenic
1092543720 12:9435977-9435999 TGGAGGAAGTTCAGGGCAGCGGG + Intergenic
1094509223 12:31086074-31086096 TGGAGGAAGTTCAGGGCAGCGGG - Intronic
1098851370 12:75600346-75600368 TGGAGGAAATTCTGAATATAGGG + Intergenic
1104322460 12:127764513-127764535 TGGAGGAAGGTCTGGGCAGCAGG - Intergenic
1104405622 12:128514034-128514056 AGGCGGAATTACTGCACAGCAGG + Intronic
1106345562 13:28873663-28873685 TTCAAGAAATTCTGCATAGCTGG - Intronic
1108426723 13:50309911-50309933 CTGAGGAATTTCTGCACTGCTGG - Intronic
1113267367 13:108634309-108634331 AGGAGGAAATTCAGGACTGCAGG - Intronic
1113676974 13:112214305-112214327 TGGAGAATCTTCTGCACAGAGGG - Intergenic
1114907148 14:27144152-27144174 TAGAAGAAATTCTGCACAAAAGG - Intergenic
1115697735 14:35918861-35918883 TGGAGGTAATTCTTGACAGTGGG - Intronic
1116203709 14:41833550-41833572 CGAAGGAAACTCTGCTCAGCAGG - Intronic
1117845315 14:59905647-59905669 TGAAGGAATTTCTGCAAAGTGGG + Intergenic
1119189477 14:72670566-72670588 TTGAGGAAATTCTCCCCACCGGG + Exonic
1120294560 14:82623423-82623445 AGGAAGAAATCCTGCACAGAGGG - Intergenic
1120486182 14:85116072-85116094 TGGAGGAACTCCAGCACAGACGG - Intergenic
1125097066 15:35866972-35866994 TTGAGAAAATGCTGCACAACTGG - Intergenic
1126836440 15:52671055-52671077 AGGAGCAAATTCAGCACAGGGGG + Intronic
1128245761 15:66131615-66131637 TGGAGGGCATTCTCTACAGCTGG + Intronic
1128583228 15:68823808-68823830 TGGAGGATATTCTGGAAGGCGGG - Intronic
1131039116 15:89245666-89245688 TGGAAGCAATTCTGCATGGCTGG + Intronic
1131069283 15:89455112-89455134 TGGAGGAAACGCTACACAGCAGG - Intergenic
1137984220 16:53094222-53094244 TATAGGAAATCTTGCACAGCAGG - Intronic
1138230567 16:55332782-55332804 TGGAGGAGATACTGAGCAGCAGG - Intergenic
1138393000 16:56683655-56683677 ATGAGGAAAGTCTTCACAGCCGG - Intronic
1141783905 16:86185460-86185482 TGGAGGAATTTCTGAAGAGAAGG + Intergenic
1142369201 16:89668884-89668906 TGGATGAAGTTCTGTACAGAGGG + Intronic
1143684121 17:8500260-8500282 TGGAGGCCAGTCTGCACAGGAGG + Intronic
1143711639 17:8739959-8739981 TGGAGGAAATAATGCAGAGGTGG + Intronic
1143717876 17:8787817-8787839 AGGAGGAAATTCTGCAGAAATGG - Intergenic
1144439952 17:15272506-15272528 TGGGGAAAATCCTTCACAGCTGG - Intergenic
1147303662 17:39548950-39548972 TGCTGGAATTACTGCACAGCTGG + Intronic
1151346163 17:73503053-73503075 TGAGGGAAATTCTGCAAAGCCGG + Intronic
1155741436 18:29293506-29293528 TGGAAGAAATTTTGGACAACAGG - Intergenic
1155956967 18:31962477-31962499 TGGAGGAAATTCTGAATATAGGG + Intergenic
1156481714 18:37440477-37440499 TGGAGGAAATGCTCCTCAGATGG - Intronic
1156573602 18:38286332-38286354 AGGAGGAAATGCTGAAAAGCTGG + Intergenic
1156681485 18:39594399-39594421 AGGAAGAAACTCTGGACAGCTGG - Intergenic
1157868218 18:51204786-51204808 TGAAGGAAATTCTGTACACTTGG - Intronic
1158689499 18:59647657-59647679 TGGAGGTAATTATTCACAGGTGG - Intronic
1159685448 18:71413546-71413568 TGCAGGTTATTCTGCATAGCAGG - Intergenic
1160370273 18:78366470-78366492 TGGAAGAAATTCTTCAAAGTGGG - Intergenic
1161915611 19:7225783-7225805 TGGAGGCGATTCTGCCCACCAGG + Intronic
1161938068 19:7384327-7384349 TGGAGGAAATTCTGCCCCCCAGG - Intronic
1162247090 19:9410485-9410507 TGGTGAAATTTCTGCACAGGTGG - Intergenic
1163436442 19:17298545-17298567 TGGGGGTAATTCTGCCCACCAGG + Intronic
1167109118 19:47448411-47448433 TGGAGGAAGGGCTGCAGAGCGGG + Intronic
925967067 2:9075920-9075942 AGGAAGGAATTCTGCACAGAGGG + Intergenic
926914922 2:17881907-17881929 TCGGTGAAATTCTGCCCAGCTGG + Intronic
927001171 2:18795393-18795415 AGGGGGATATCCTGCACAGCTGG - Intergenic
928911875 2:36430085-36430107 CGGAGGAACTTTTGCACATCTGG - Intronic
930516763 2:52418128-52418150 TGGTGGAAAGTCTGTGCAGCTGG - Intergenic
930899837 2:56491653-56491675 TGGAGAAAATTAAGCACAGGCGG + Intergenic
935984766 2:108661806-108661828 TGAAGGGAATTCTGGAAAGCTGG + Intronic
936137201 2:109905457-109905479 TGAAGGGAATTCTGGAAAGCTGG + Intergenic
936156681 2:110051517-110051539 TGGAGGAAGTTCAGCACAGCAGG - Intergenic
936188011 2:110319927-110319949 TGGAGGAAGTTCAGCACAGCAGG + Intergenic
936207496 2:110466028-110466050 TGAAGGGAATTCTGGAAAGCTGG - Intronic
936267205 2:111019798-111019820 TAGAGCAAATTCAGCACAGGGGG - Intronic
940116505 2:150214869-150214891 GGGAGGGAATTCCTCACAGCTGG + Intergenic
940171843 2:150837140-150837162 TGGGGGAAATTATGCAAAGAAGG - Intergenic
947197884 2:227586688-227586710 TAGAGGAAATTCTTCCCAACAGG + Intergenic
947743379 2:232495240-232495262 TGGAGGGAATTCTCCATTGCTGG - Intergenic
947834569 2:233166229-233166251 CCGAGCATATTCTGCACAGCGGG - Intronic
1168976945 20:1973926-1973948 TGGAGGATTTTCAGCACAGGAGG - Intergenic
1173576423 20:44115518-44115540 AGGAGGAAATGCTGCAGGGCTGG - Intronic
1176010301 20:62889925-62889947 TGGAGCCCATTCTTCACAGCTGG - Intronic
1177814605 21:25962479-25962501 TGAAGGATATTCTGCACTACTGG - Intronic
1178095415 21:29209948-29209970 TGGAGGAAATTATGAACACAGGG + Intronic
1179257473 21:39729316-39729338 TGGTGGAAATTCTGATCAGTGGG - Intergenic
1181091145 22:20473354-20473376 TGGAAGAAAATCTGGACAGCTGG + Intronic
1182285588 22:29245148-29245170 AGGAGGAGATTCAGGACAGCAGG - Intronic
1184115526 22:42419687-42419709 GGTAGGACATTCCGCACAGCCGG - Intronic
1184152444 22:42646732-42646754 TGGAGGAAGTTCTGCAGTGGGGG + Intronic
952194433 3:31058520-31058542 TGGAGGAAATTTTGCAGAAATGG + Intergenic
952512515 3:34071438-34071460 TCATGGAAATTCTGAACAGCAGG - Intergenic
953679558 3:45029193-45029215 TGGAGGAAACTTTGCACATATGG + Intronic
954709464 3:52498146-52498168 TGGATGAAATTCTCCCAAGCTGG - Intronic
956339709 3:68208760-68208782 TGGAGGAAATTCTGCACAGCAGG - Intronic
956930821 3:74040855-74040877 TGAAGGAAATACTGAAGAGCTGG - Intergenic
957322683 3:78652956-78652978 AGGTGGGAATTCTGCACAGTGGG - Intronic
958695799 3:97526370-97526392 TTGAAGCAATTCTGCCCAGCTGG - Intronic
959102295 3:102024863-102024885 TTGAGGAAATTATCCAGAGCTGG + Intergenic
959247664 3:103895567-103895589 TGGTGGAAATTTAGTACAGCCGG + Intergenic
960544053 3:118891702-118891724 TGGAGGAAATTCTACGTAGAAGG - Intergenic
964686875 3:159404921-159404943 TCCAGGAAATTCAGCACAGAGGG + Intronic
965098974 3:164272824-164272846 TGCAGGAAAATCCGCTCAGCTGG + Intergenic
965561235 3:170063958-170063980 TTCAGGAAATTCTGCCCGGCAGG - Intronic
966561741 3:181328481-181328503 TGGGGGAAACTCTGCCCAGATGG + Intergenic
967156369 3:186696217-186696239 TGCAGGAAATGCTGCACAGAGGG - Intergenic
968980083 4:3842807-3842829 TGGGGGAACTTCTGGAAAGCTGG + Intergenic
971284470 4:25274368-25274390 TGGAGCAAATTCTGCAGGCCAGG - Intronic
972129398 4:35811320-35811342 TGGAGGAAATTATGCAGACTTGG + Intergenic
972646508 4:40973086-40973108 TGGAGAATATTCTGCACATTTGG - Intronic
972646715 4:40974942-40974964 TGGAGAATATTCTGCACATTTGG - Intronic
973961902 4:56118824-56118846 TGGAGAAATTACTGCACAGAAGG - Intergenic
974694218 4:65344467-65344489 TGGATGATCTGCTGCACAGCTGG + Intronic
974896835 4:67950372-67950394 TGAGGGAAATTCTCCACTGCTGG - Intronic
977254419 4:94725192-94725214 TGGATGAGATGCTGCACAGAGGG + Intergenic
978212593 4:106156455-106156477 TGGAGGAACTTCTGCCCTGAAGG - Intronic
979593208 4:122504541-122504563 GGGAGGAATTTCTGCAAAGCAGG - Intergenic
980282513 4:130738660-130738682 TAGAGGAAATTCTCCTCATCAGG + Intergenic
982931821 4:161417928-161417950 TGGAGGAAATTAAGTACAGCAGG + Intronic
984751711 4:183283981-183284003 CTTAGGAAGTTCTGCACAGCAGG - Intronic
988735141 5:34013090-34013112 TGGTGCCAATCCTGCACAGCTGG - Intronic
988878333 5:35472954-35472976 TGCAACGAATTCTGCACAGCTGG - Intergenic
988884567 5:35541915-35541937 TGGAGGACATTCTCACCAGCAGG - Intergenic
991000472 5:61777623-61777645 AGGAGGATATTCTGCCCAGACGG - Intergenic
992637600 5:78739871-78739893 AGGAGAAAATTCTGAACAGAAGG + Intronic
992955766 5:81906625-81906647 TGGTGGAAATTCTTCAAACCTGG + Intergenic
994432308 5:99683060-99683082 TGGAGGAATTTATGAACAACTGG - Intergenic
995323618 5:110865716-110865738 AGGATGAGATTCAGCACAGCTGG + Intergenic
998100148 5:139425993-139426015 TGGTCAAAATTATGCACAGCTGG + Intronic
998551368 5:143080920-143080942 TGGTGGAAATGCTGAACAGTGGG + Intronic
999304656 5:150511819-150511841 TGGAGAAACTCCCGCACAGCTGG + Intronic
1001090553 5:168737102-168737124 TCCAGGAAATTCTGCCCACCTGG - Intronic
1001987907 5:176091377-176091399 TGCTGGAATCTCTGCACAGCTGG + Intronic
1001988036 5:176092516-176092538 TGATGGAATCTCTGCACAGCTGG + Intronic
1001998057 5:176177806-176177828 TGCTGGAATTCCTGCACAGCTGG - Intergenic
1002040415 5:176509606-176509628 TAGAGGAAATTCTGCAGAAGTGG - Exonic
1002228832 5:177745624-177745646 TGCTGGAATCTCTGCACAGCTGG - Intronic
1002228965 5:177746764-177746786 TGCTGGAATCTCTGCACAGCTGG - Intronic
1002266382 5:178037019-178037041 TGCTGGAATCTCTGCACAGCTGG + Intronic
1002266514 5:178038159-178038181 TGCTGGAATCTCTGCACAGCTGG + Intronic
1002290854 5:178199771-178199793 TAAAAGAAATTCAGCACAGCTGG + Intergenic
1003152419 6:3563991-3564013 TGGGGGAAATTCTCCAAACCTGG - Intergenic
1003712646 6:8609987-8610009 TGGAGGAAACTGTGCATGGCGGG - Intergenic
1003860595 6:10319019-10319041 AGGAGGAAAATGTCCACAGCTGG + Intergenic
1005500184 6:26422659-26422681 TGGAGGAAATTCTCCTCATGGGG + Intergenic
1005744894 6:28827339-28827361 GGCAGGACATTCTGGACAGCTGG + Intergenic
1008905320 6:56671344-56671366 TGGATCAAATTCTGCTCTGCAGG - Intronic
1009273776 6:61649072-61649094 TGGAGGAAGTCCTTCACAGCAGG + Intergenic
1010373158 6:75135103-75135125 TGGATGAAATTTTGCAGTGCTGG - Intronic
1011310015 6:85971496-85971518 TTGAGGAAATACTGCACATCTGG - Intergenic
1012262288 6:97101311-97101333 TGGAGGTAATCCTGCAAATCTGG - Intronic
1012526342 6:100182473-100182495 TGGAGCAAATGCAGCTCAGCTGG + Intergenic
1014102327 6:117525357-117525379 TCCAGCAAATTCTGCCCAGCTGG + Exonic
1014102693 6:117529370-117529392 TCCAGCAAATTCTGCCCAGCTGG + Intronic
1014761333 6:125360039-125360061 TCGAGGAGATACTTCACAGCTGG + Intergenic
1018079650 6:160247829-160247851 TGGAGGGAACTCTGAGCAGCTGG + Intronic
1019630801 7:2048669-2048691 TGGAGGAGGTTCTTCACAGAGGG - Intronic
1019809345 7:3153044-3153066 TGGAGGAACCTCTGAACACCTGG + Intronic
1020140659 7:5609741-5609763 TGGAGGAAATGGGGCCCAGCTGG - Intergenic
1024427536 7:49244677-49244699 TAGTGGTAAATCTGCACAGCAGG - Intergenic
1024662814 7:51515018-51515040 AACAGGAAATTCTTCACAGCAGG - Intergenic
1026913394 7:74105897-74105919 TGGATGGAATTCTTCACATCTGG - Exonic
1027752120 7:82162473-82162495 AGGAGGTCATTTTGCACAGCAGG + Intronic
1028471679 7:91212920-91212942 TGGAGGGCATGCTGCACAGATGG + Intergenic
1032000083 7:128259555-128259577 TGGAGGAACAGCTGCACAGCAGG - Intergenic
1032998917 7:137481215-137481237 GGGAGCAAATTCTTCCCAGCTGG + Intronic
1034307738 7:150059102-150059124 TGTAGGACATACTGCACACCTGG + Intergenic
1034956906 7:155340441-155340463 AGGAGGCCGTTCTGCACAGCGGG - Intergenic
1039022424 8:33222626-33222648 TGCAGGCAATTCGGCACAGGAGG - Intergenic
1039954879 8:42199484-42199506 TGGAGAAAATTCTGCTCTGATGG - Intronic
1041422378 8:57682303-57682325 TGGAGAAAATGTTGCACAGGTGG - Intergenic
1045816190 8:106279873-106279895 TGAAGGAAATTCTGAAGAGCAGG + Intronic
1046384273 8:113488541-113488563 CGGAGAAAATTCTACAAAGCAGG - Intergenic
1048520192 8:135146653-135146675 ATGAGGAGATTCTGCACAGATGG + Intergenic
1051038423 9:12776591-12776613 TCGAGCAGATTCTCCACAGCTGG + Intronic
1052250059 9:26387814-26387836 TTAAGGAGCTTCTGCACAGCAGG - Intergenic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1058652044 9:107184632-107184654 TTGATGATATTCTGCACAGATGG - Intergenic
1062037871 9:134390718-134390740 TGGGGGAAGTCCTGCTCAGCGGG + Intronic
1062249885 9:135588711-135588733 TGGAGATCATTCTGCACAGATGG + Intergenic
1185669269 X:1792841-1792863 TGGAGGTGATTCTGCCCAGAGGG - Intergenic
1187311578 X:18149320-18149342 TGGGGGAAGTTCTGCAAAGAAGG - Intergenic
1187564524 X:20435148-20435170 TGGATGAACTTCTGCAGAGCAGG + Intergenic
1189395348 X:40617658-40617680 TGAAGGATATTCTCCATAGCCGG - Intergenic
1192545572 X:72009950-72009972 TAGAGGAAACTGTGAACAGCAGG - Intergenic
1199591051 X:149468919-149468941 TGGAGGAAATCCTGCTCCCCTGG + Intergenic
1201282003 Y:12350390-12350412 TGGAAGAAATCCTGTACTGCTGG - Intergenic
1202348556 Y:23961735-23961757 TGGAGCAACTTCTGCACCACTGG - Intergenic
1202522218 Y:25708369-25708391 TGGAGCAACTTCTGCACCACTGG + Intergenic