ID: 956343189

View in Genome Browser
Species Human (GRCh38)
Location 3:68249065-68249087
Sequence CCTTCCCTACTGAAGGTAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 3, 2: 25, 3: 67, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956343185_956343189 -7 Left 956343185 3:68249049-68249071 CCTCTTGAACCTGGTGCCTTCCC 0: 23
1: 82
2: 115
3: 103
4: 276
Right 956343189 3:68249065-68249087 CCTTCCCTACTGAAGGTAATAGG 0: 1
1: 3
2: 25
3: 67
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956343189 Original CRISPR CCTTCCCTACTGAAGGTAAT AGG Intronic
903544228 1:24113599-24113621 CCTTCCCTACTGAGGTTAATAGG + Intergenic
904295799 1:29519117-29519139 TCTTCCCTACTGAAAGCCATGGG - Intergenic
906379062 1:45320140-45320162 CCCTCCCTACTCAAGGCAAATGG + Intergenic
906819323 1:48912768-48912790 CCTTCCCTATTGAGGTTACTAGG + Intronic
908802889 1:67898242-67898264 CCATCCCTACTGAAGTCAATAGG - Intergenic
914323439 1:146587418-146587440 CCTTACCTAGGGAAGGTACTGGG + Intergenic
916201329 1:162274239-162274261 CCATCCCTACTGAAGTCAACAGG - Intronic
919017746 1:192062034-192062056 CTATCCCTATTGAAGATAATAGG + Intergenic
919600673 1:199618339-199618361 CCTTCCATATTGAGGGTAATAGG + Intergenic
920761016 1:208783789-208783811 CCTTCCCTATTGAGGTTAATAGG - Intergenic
920839234 1:209540005-209540027 CCTTCCCTACTGAGGTCAAAAGG - Intergenic
920871299 1:209797409-209797431 CCTTCCCTCCTAAAGGCACTTGG - Intronic
921067759 1:211634649-211634671 GCTTCCATACTGTAGGCAATAGG + Intergenic
922346414 1:224700228-224700250 CCCTCCCTAGTGAGGTTAATAGG + Intronic
1064422844 10:15205171-15205193 CCATCCCTACTGAGATTAATAGG + Intergenic
1065382455 10:25103531-25103553 CCATCCCTATTGAAGTCAATAGG - Intergenic
1068119444 10:52771149-52771171 CCATCCCTACTGAAGTGAATAGG + Intronic
1068521266 10:58080110-58080132 CCATCTCTACTGAAGTCAATAGG + Intergenic
1068685757 10:59868575-59868597 CCCTCCCTACTGAGGTTGATAGG + Intronic
1069816234 10:71196320-71196342 CCTTCCCTATTGAGGCTAACAGG - Intergenic
1072004166 10:91226878-91226900 CCTGGCCTACTGAAGGGAAGAGG - Intronic
1072748364 10:97958095-97958117 CCTTCTCTACTGAGGTTAATAGG + Intronic
1072748619 10:97959817-97959839 CCTTCCCTATTGAGGTTAATAGG + Intronic
1073650418 10:105352644-105352666 CCTTCCCTATTGTGGTTAATAGG + Intergenic
1074283790 10:112079177-112079199 CCTTCCCTGCTGAAGTTAACAGG + Intergenic
1074884493 10:117683870-117683892 CCTTCCCTACTGAGGTTAATAGG + Intergenic
1075006202 10:118831965-118831987 CCTTCCCTATTGAGATTAATAGG + Intergenic
1075174801 10:120149408-120149430 GCTTCCCTACTGAGGTTAACAGG + Intergenic
1075499453 10:122959176-122959198 CCTTCTCTAGTGAGGTTAATGGG + Intronic
1076572842 10:131443913-131443935 CCATCCCTACTGGAGTTGATAGG - Intergenic
1077591883 11:3498803-3498825 CCTTCCCTAGTCAAAGAAATGGG - Intergenic
1077646771 11:3932259-3932281 CCTTCCCTATGGAAGTTAACAGG + Intronic
1078370891 11:10744047-10744069 CTTTCCCTATTGAGGTTAATAGG + Intergenic
1078418314 11:11184357-11184379 CTTTCCCTACTGAGGCAAATCGG - Intergenic
1078540826 11:12211682-12211704 CTTTCCCTATTGAGGTTAATAGG - Intronic
1079359105 11:19755766-19755788 CCTTCCCTACTGAGAATAATAGG - Intronic
1081238064 11:40670203-40670225 CCTTGTCTAGTGAAGGTGATAGG - Intronic
1081610947 11:44563130-44563152 CCATCCCTACTGAAGTTAATAGG - Intergenic
1081950734 11:47040454-47040476 CCATCCCTACTGAAGTCAATAGG - Intronic
1082313954 11:50694664-50694686 CCTTCCCTAGTGAAAGAAAGGGG + Intergenic
1084247723 11:67871539-67871561 CCTTCCCTAGTTAAAGAAATGGG - Intergenic
1087610956 11:100433398-100433420 CCATCCCTATTGAAGTTAATAGG + Intergenic
1095188177 12:39225773-39225795 ACTTCCCTACTGAGGTTAATAGG - Intergenic
1095977977 12:47952618-47952640 CCCTCCCTACTGAAGTGAATAGG - Intergenic
1098722055 12:73912741-73912763 CCTTCCCTATTGGAGTCAATAGG - Intergenic
1102099447 12:110267096-110267118 ACTTCCCTGCTGACGATAATGGG - Intergenic
1102790609 12:115641971-115641993 ACTTACCTACTGAAGGTAAGTGG - Intergenic
1102802571 12:115749403-115749425 CCTTCCCCAATGGAAGTAATTGG - Intergenic
1102823879 12:115930283-115930305 ACTCCCCTGCTGAAGGCAATTGG + Intergenic
1106061766 13:26300038-26300060 CATTGACTACTGAAGGTAGTAGG - Intronic
1106126606 13:26904897-26904919 CCATCCCTACTGAAGTTAATAGG + Intergenic
1106797178 13:33218513-33218535 CCATCTCTACTGAAGTGAATAGG + Intronic
1107006569 13:35619273-35619295 CCATCCCTGTTGAAGTTAATAGG - Intronic
1107817149 13:44254414-44254436 CCTTCCCTATTGAGGTTAACAGG + Intergenic
1108890520 13:55252579-55252601 TCTTCCTTATTGAAGGTAATTGG + Intergenic
1109207318 13:59496916-59496938 TCTTCCATACTGACGGTTATGGG + Intergenic
1109287924 13:60433915-60433937 CTTTCCTTACTGATGGTAAAGGG + Intronic
1112096268 13:96135713-96135735 CCATCCCTGCTGAAGTTAATAGG - Intronic
1112637173 13:101227731-101227753 CCTTCCCTACTAGAGTTGATAGG + Intronic
1115156097 14:30341007-30341029 CCATTCCTGCTGAAGTTAATAGG - Intergenic
1116207270 14:41884448-41884470 CCTTCCCTACTGAGGTTAAGAGG - Intronic
1117374848 14:55110900-55110922 CCTGACCTACTGGAGTTAATGGG + Intergenic
1117860563 14:60088093-60088115 CCATCCATACTGAAGTGAATGGG + Intergenic
1118199879 14:63662330-63662352 CCTTCCTTACAGAGGTTAATAGG - Intergenic
1119858370 14:77918135-77918157 CCATCCCTACTGAAGTTGACAGG - Intronic
1121177460 14:91901476-91901498 CCTTCCTTGCTCAAGCTAATGGG + Intronic
1121280994 14:92698017-92698039 ACATCCCCACTGAAGGGAATAGG + Intergenic
1122257161 14:100486837-100486859 CCTTCCCTACTGTATTTAAAAGG - Intronic
1124002580 15:25771175-25771197 CCTTCCCCACTGAGGTTAACAGG + Intronic
1125379444 15:39071796-39071818 CTTTCCCAACTGATGCTAATTGG - Intergenic
1125898557 15:43324252-43324274 CCTTCATTACTGAAGTTAAAAGG + Exonic
1125899418 15:43330938-43330960 CCTTGCCTACTGAAGGTCCGTGG - Intronic
1127147057 15:56035460-56035482 CCTTCCCTACTGAGGTTAATAGG - Intergenic
1128006313 15:64245016-64245038 CTTTCCCTACTGAATGTTCTTGG - Intronic
1129516152 15:76158982-76159004 CCCTCCCTGCTGAAGGCACTGGG + Intronic
1131425382 15:92341555-92341577 CCTTCCCTACTGAGGTTAACAGG + Intergenic
1131537761 15:93251934-93251956 CCTTCCCTACCGAAGTTAATAGG - Intergenic
1131542012 15:93282282-93282304 CCTTCCCCACTGGAGTCAATAGG + Intergenic
1133444485 16:5848376-5848398 CCTTCCCCACTGAGGTTAACAGG + Intergenic
1135566077 16:23512085-23512107 CCATCCCTACTGAAGTTAATAGG - Intronic
1136102857 16:28008438-28008460 CCATCCCTCCTGAAGTTAAGAGG + Intronic
1136130335 16:28216416-28216438 CTTTCCCTACTGATCCTAATTGG + Intergenic
1136515772 16:30767471-30767493 CCTTCTCTATTAAAGGGAATTGG + Intronic
1138522060 16:57576688-57576710 CCTTTCCTCCTGGAGGAAATGGG - Exonic
1139730892 16:68944373-68944395 CTTTCCCAACTGAAGGGAAAAGG + Intronic
1140010123 16:71123432-71123454 CCTTACCTAGGGAAGGTACTGGG - Intronic
1140776162 16:78250567-78250589 CCTTTCCTATTGAGGTTAATAGG - Intronic
1140784515 16:78327420-78327442 CCTTCCACACTGAGGGTACTGGG - Intronic
1141368541 16:83466246-83466268 TCTTCCTTACTGAGGTTAATAGG - Intronic
1141512191 16:84519622-84519644 CCTTCCCTATTGAGGTTAATAGG + Intronic
1146378023 17:32307853-32307875 CTTCCCCTACTGAAAGGAATTGG - Intronic
1146471718 17:33130138-33130160 CCTTCTCTACTGAGGTTAATAGG + Intronic
1146557803 17:33841786-33841808 CCTTCCCTATTGAGGTTGATAGG - Intronic
1148969265 17:51465035-51465057 CCATCCCTGTTGAAGTTAATAGG - Intergenic
1149220867 17:54414215-54414237 CCTTCCCCACTCAAGGCAAATGG + Intergenic
1151361399 17:73591356-73591378 CCTTCCCTATTGAGGTTAACAGG + Intronic
1151376090 17:73690108-73690130 CCTTCCCTACGGAGGTTAACAGG + Intergenic
1153150750 18:2089791-2089813 CCTTCCCTAATGAGGTTAAGAGG + Intergenic
1155072557 18:22329261-22329283 CCTTCCCTACTGGGGTTAATAGG - Intergenic
1155250820 18:23951641-23951663 CCTGCCTTCCTGAAGGAAATAGG + Intronic
1156996855 18:43479173-43479195 CCTTCCATACTGAGGTTAATAGG + Intergenic
1157900677 18:51513854-51513876 CCTTACCATCTGAAGCTAATGGG + Intergenic
1158877340 18:61745821-61745843 CAATCCCTACTGAAGTTAACAGG + Intergenic
1159003462 18:62992773-62992795 CCATCCCTACTGGAGTTAACAGG - Intergenic
1159929488 18:74296471-74296493 CCCTCCCCACTCAAGGTAAATGG + Intergenic
1165810928 19:38611249-38611271 CCTCCCCGACTGAAGGAAAAAGG - Exonic
1168695443 19:58401414-58401436 CCTTCCCTACCTCACGTAATAGG - Intergenic
927018650 2:18995221-18995243 CCATCCCTACTGAAGTTATTAGG - Intergenic
928002121 2:27532952-27532974 CTATCCCTACTGAAGTCAATAGG - Intergenic
928545076 2:32322067-32322089 CCATCCCTACTGGAGTCAATAGG + Intergenic
929370188 2:41213968-41213990 CCTTTCCTAGTGCAGGTAAATGG + Intergenic
929411634 2:41703391-41703413 CCACCCCTATTGAAGCTAATAGG - Intergenic
930314799 2:49784958-49784980 ACTTCCCTATTGAGGTTAATAGG - Intergenic
930602052 2:53454849-53454871 CCACCCCTATTGAAGTTAATAGG - Intergenic
930607283 2:53505712-53505734 CCATCCCTATTGAAGTTAGTAGG - Intergenic
931849122 2:66235229-66235251 CCTTCCCTATTGAGGTGAATAGG + Intergenic
932013187 2:67998817-67998839 CCTTCCCTACTGGGGTGAATAGG + Intergenic
933183574 2:79254155-79254177 TCTGCCCTACAGAGGGTAATAGG - Intronic
933653016 2:84864471-84864493 CCATCCCCACTGAAGTCAATAGG + Intronic
935523967 2:104143302-104143324 CCATTCCTACTGAAGTTAATAGG - Intergenic
935662865 2:105484960-105484982 CCTTCCCTACTGAGGTTCATAGG + Intergenic
938614865 2:132987215-132987237 CTGTCCCTACTGAAGTTAATAGG + Intronic
938684993 2:133729453-133729475 CCATCCCTATTGAGGTTAATAGG + Intergenic
939881430 2:147635730-147635752 CCATCCCTATTGAAGTAAATAGG + Intergenic
941634778 2:167924819-167924841 CCTGCCCTAATGAAGATGATGGG + Intergenic
941700295 2:168597109-168597131 CCATCCCTACTGAAGTCAATAGG - Intronic
941869216 2:170366198-170366220 CCATCCCTACTGAAGTTAATAGG + Intronic
942545537 2:177059771-177059793 CCTTGACTGCTGAAGGTAATAGG + Intergenic
942576176 2:177365756-177365778 AGGTCCCAACTGAAGGTAATGGG - Intronic
942787083 2:179712031-179712053 CCATCCCTATTGAAGTCAATAGG + Intronic
942960774 2:181828079-181828101 CCTTCCCTACTGAGGTTAACAGG - Intergenic
943759430 2:191592327-191592349 CCTTCCCCACTGGAGTCAATAGG + Intergenic
944837240 2:203591938-203591960 ACTTCCCTACTGCAGGTTACTGG + Intergenic
945473425 2:210253548-210253570 CCATCCCTGCTGAGGTTAATAGG + Intergenic
945969259 2:216220224-216220246 CCTTCCCTATTGAAGTTAATAGG + Intergenic
946434521 2:219642901-219642923 CCTTCCCCACTGGAGTTCATAGG - Intergenic
946870372 2:224079113-224079135 CCTTCCCTATTGAGGTTAACAGG - Intergenic
947508260 2:230726804-230726826 CCTTCCCTACAGAAGCTGAAAGG + Intronic
947843024 2:233220829-233220851 CCATCCCTATTGAAGGTAATAGG + Intronic
947942724 2:234072641-234072663 CCTGCCCTGCTAAAGGTCATGGG - Intronic
1169576191 20:6964459-6964481 CATAACCTACTGAAGGTAAGAGG + Intergenic
1169641862 20:7761119-7761141 CCATCCCTACTGAAGCCAAGAGG + Intergenic
1170539123 20:17370662-17370684 CCTTCCCTACTGAACATGAGTGG + Intronic
1170548706 20:17456985-17457007 CCTTCCAAGCTGAAGGTAAGAGG + Intronic
1171281474 20:23902754-23902776 CCTTTCCTACTCAAGGAAAGGGG - Intergenic
1171308667 20:24127850-24127872 CTTTCCCTACTGAGGTTAATAGG - Intergenic
1171968501 20:31548815-31548837 CATTCCCTCCTGTAGGAAATTGG + Intronic
1174995792 20:55566991-55567013 CCATCCCTTCTGAAGTTAACAGG - Intergenic
1175532007 20:59680187-59680209 CCTTCCCTACTGAGGTTAACAGG - Intronic
1181563339 22:23718189-23718211 CCTTCCCTACTGGAGTAAAGTGG - Intergenic
1182975652 22:34621821-34621843 CCCTCCATAGTGAAGGTAAAAGG - Intergenic
1183003034 22:34877393-34877415 GCTTCCCTACTGAGGTTAATAGG + Intergenic
1183331539 22:37224772-37224794 CCTCCACTACTGGAGGTCATGGG - Intergenic
1183680188 22:39323904-39323926 CCTTCCCTATTGAGGTTAATAGG + Intergenic
949626622 3:5874466-5874488 TCTTCCCTATTGAGGTTAATAGG + Intergenic
949675195 3:6445280-6445302 CCATCCCTACTGGAGTCAATAGG - Intergenic
950786482 3:15440708-15440730 CCTACCCTAGTGTAGGTAATAGG + Exonic
953129927 3:40128108-40128130 CCTTCCCTACTGAGGTTAATAGG - Intronic
953781365 3:45873914-45873936 CCATCACTACTGATGGTGATAGG - Intronic
954176734 3:48850841-48850863 CCATCCCTACTGAAGTTAATGGG - Intergenic
955102850 3:55869041-55869063 CTTTCCCTCATGAAGGTATTAGG - Intronic
955442799 3:58974993-58975015 CCTTCCCTACTGAGGTTAGTAGG + Intronic
955643272 3:61109628-61109650 CCATCCCCACTGAAGTTGATAGG + Intronic
956343189 3:68249065-68249087 CCTTCCCTACTGAAGGTAATAGG + Intronic
956380018 3:68655186-68655208 GCTTCCCTACTGAGGTTAATAGG + Intergenic
958166659 3:89885326-89885348 CCTTCCCTACCCAAGGAAAGGGG - Intergenic
958908346 3:99966036-99966058 CCTTCCCTGCTGAGGTTAATAGG + Intronic
959577802 3:107953580-107953602 CCATCCCTACTGAGGTTGATAGG - Intergenic
961426932 3:126855764-126855786 CCATCCCTACTGAAGTTAATAGG - Intronic
961854539 3:129856848-129856870 CCATCCCTATTGAGGTTAATAGG - Intronic
961895705 3:130166312-130166334 CCTTCCCTAGTCAAAGAAATGGG - Intergenic
962220176 3:133558350-133558372 CCATCCCTATTGGAGTTAATAGG + Intergenic
963983151 3:151562742-151562764 CCTTCCCTACTGGAGTCAATAGG - Intergenic
965823282 3:172706087-172706109 CCTTCACTACTGAGGTTAATGGG + Intronic
967782119 3:193451147-193451169 CCTTCCCTATTGAAGTGCATGGG + Intronic
969048167 4:4353510-4353532 CCTTCCCTACTGAGGTTAATAGG - Intronic
969062065 4:4444324-4444346 CCATCCCTACTGAAGTTAACAGG + Intronic
970958505 4:21844087-21844109 CCTTACATGTTGAAGGTAATGGG + Intronic
971520021 4:27538040-27538062 CCATCCCTATTGAAGTTAACAGG - Intergenic
971606664 4:28666720-28666742 CCTTCTCTATTGAGGTTAATAGG + Intergenic
971752357 4:30666742-30666764 CCTTCCCTACTGAGGTTAATAGG + Intergenic
972274198 4:37541783-37541805 CCTTCCCTATTGAGGTTAATAGG - Intronic
972292978 4:37707833-37707855 CCATCCCTACTGAAGTTAATAGG + Intergenic
974085486 4:57256012-57256034 CCTTCCCAACTGTAAGAAATTGG + Intergenic
975719253 4:77234296-77234318 TCTTCCCTATTGAGGTTAATAGG + Intronic
977237000 4:94520006-94520028 CCTTTCGTACTGAAGTTAATGGG + Intronic
977380092 4:96262070-96262092 CCTTCCCTATTGAGGTGAATAGG - Intergenic
979203560 4:118008004-118008026 CCTTCCCTATTGAGGTTAATAGG + Intergenic
980232526 4:130062780-130062802 CCTTCCCAAATGAAGGCAAATGG - Intergenic
981090338 4:140725699-140725721 CCTTCCCTCCTGGAGTTAATAGG + Intronic
984629814 4:182049523-182049545 ACTTCCCCGCTGAAGCTAATGGG - Intergenic
987148536 5:15016215-15016237 CCTTAGCTACTCAAGCTAATTGG - Intergenic
988665928 5:33327314-33327336 TCTTTTCTACAGAAGGTAATAGG + Intergenic
989456349 5:41648630-41648652 CTTTAACTACTGAAGGAAATTGG + Intergenic
990141235 5:52706703-52706725 CCATCCCTACTGAAGTTAATAGG - Intergenic
991658164 5:68923846-68923868 CCATCCCTAGTAAAGTTAATAGG + Intergenic
993797819 5:92290813-92290835 CTTCCCATACTGAAAGTAATAGG - Intergenic
994075285 5:95643332-95643354 CCTTTCCTACTGAGGTTAATAGG + Intergenic
997247667 5:132364748-132364770 CCATCCCTACTGAAGTCAATGGG - Intergenic
997890651 5:137673389-137673411 CCATCCCTATTGAAGTTAATAGG + Intronic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
999824399 5:155260071-155260093 CCTTCCCTATTGAGGTTAATAGG + Intergenic
1000036791 5:157454997-157455019 CCTTCCCTATTGAGGTGAATAGG - Intronic
1001951415 5:175819350-175819372 CATTCCCTACTGTAGCTACTTGG + Intronic
1003272707 6:4621509-4621531 CCTTCCCTACCGAGGTTAATAGG - Intergenic
1003600688 6:7514438-7514460 CCTTCCCTATTGAGATTAATAGG - Intergenic
1003849047 6:10203125-10203147 CCATCACTATTGAAGCTAATAGG + Intronic
1006174980 6:32116271-32116293 CCTTCCCTGGTGAAGGTGCTTGG - Intronic
1007204331 6:40136237-40136259 CCATCCCTACTTAAGTTAGTAGG + Intergenic
1007802493 6:44408096-44408118 CCTTCCCTACAGAATGTGAGGGG - Intronic
1007948779 6:45850842-45850864 CCTTCCCCACTGGTGCTAATAGG - Intergenic
1008556040 6:52673526-52673548 CCTTCCTTATTGAGGTTAATAGG + Intronic
1008558066 6:52694491-52694513 CCATCCCTATTGAAGTCAATAGG + Intergenic
1008727924 6:54443556-54443578 CCTTCCTTATTGAGGTTAATAGG - Intergenic
1010208394 6:73343240-73343262 CCATCCTTACTGAAGTTAATAGG + Intergenic
1010924747 6:81731239-81731261 ACTTTCCTACTTAAGTTAATTGG - Intronic
1011881647 6:92035148-92035170 CATACCCTTCTGAAGGTCATGGG + Intergenic
1011948783 6:92938182-92938204 CTATCCCTACTGAAGTTAATAGG - Intergenic
1013631582 6:111991324-111991346 CCTTCCCTACAGAGGTTAATAGG - Intergenic
1014281362 6:119445650-119445672 CCATCCCTAATGAAGTTAATAGG + Intergenic
1016124256 6:140380446-140380468 CCTTCCCTATTGAGATTAATTGG - Intergenic
1018149944 6:160928003-160928025 CCTTCCCACCTGAAGGTCAAGGG - Intergenic
1019040686 6:169101747-169101769 CCTTACCTGCTGAAGGCAAATGG - Intergenic
1021611870 7:22465640-22465662 CCTTCCCTATTGAGGTTAATAGG - Intronic
1021613044 7:22476255-22476277 CCATCCCTATTGAGGTTAATAGG - Intronic
1021984591 7:26086292-26086314 CCTTCCCTACTGAGGTTAATAGG + Intergenic
1022346142 7:29516400-29516422 CCATCCCTACTGAAGTTAATAGG + Intergenic
1022413016 7:30154024-30154046 CCTTCCCTACTGAGGTTAAAGGG - Intronic
1022811441 7:33872718-33872740 CCATCCCTACAGAAGTCAATAGG + Intergenic
1023661850 7:42478362-42478384 CCTTCCCTACTGAGGTTAATAGG + Intergenic
1023700365 7:42886453-42886475 CCTTCTCATCTAAAGGTAATAGG + Intergenic
1024176476 7:46845625-46845647 CCTTCCCTATTGAGGCTAATAGG + Intergenic
1025929601 7:65983053-65983075 CCTTCCCTACTGGAGTAAACTGG - Intergenic
1028502653 7:91536001-91536023 CGTTCCCTATTGAAGTTAATAGG + Intergenic
1030317257 7:108128310-108128332 CCATCCCTACTGAAGTCAATAGG + Intronic
1033936535 7:146592738-146592760 CCATCCTTATTGAAGTTAATAGG - Intronic
1034513872 7:151558459-151558481 CCTTCTCTACTGAAGAAATTGGG + Intronic
1035917867 8:3644631-3644653 CCCTCTTTACTGAAGGTAATAGG - Intronic
1038454193 8:27661775-27661797 CCTTCCCTCCTGAAGGGTCTGGG + Intronic
1039133562 8:34294908-34294930 CCTTCCCTACTGAGGTTAATAGG + Intergenic
1039369913 8:36973930-36973952 CCTTCCCTATTGAGGTTAATAGG - Intergenic
1040273655 8:45985899-45985921 CCTTTCCTAGTGAAAGTAAGGGG - Intergenic
1041765385 8:61413342-61413364 CCTTTCCTGCTGAAGTTAATAGG - Intronic
1041793567 8:61722829-61722851 CCTTCCCTACTGAAGTTAATAGG + Intergenic
1043345321 8:79291433-79291455 CGTTCCCTTCTGGAGGTACTAGG - Intergenic
1043433232 8:80214472-80214494 CCTTCCCAACTGAGGTTAATAGG - Intronic
1043946557 8:86260576-86260598 CCATCCCTACTGAAGTTAATAGG - Intronic
1044327879 8:90881095-90881117 CTTTCCATCCTGAAGGCAATGGG + Exonic
1044738328 8:95301362-95301384 CCTTCTCTATTGAGGTTAATAGG - Intergenic
1044783229 8:95765328-95765350 CCTTCCCCATTGACTGTAATTGG - Intergenic
1044829527 8:96233566-96233588 CCTTCATTTCTGAAGGTAACAGG - Intronic
1045644340 8:104285406-104285428 CCATCCCTACTGGAGTCAATAGG - Intergenic
1045645384 8:104292427-104292449 CCATCCCTACTGGAGTCAATAGG - Intergenic
1046026370 8:108729129-108729151 CATTCCTTACTGAAGGCAAAGGG + Intronic
1047093045 8:121594613-121594635 CCTTTCCTATTGAGGTTAATAGG - Intergenic
1047586677 8:126281034-126281056 CATTCCCTACTAAAAGGAATTGG + Intergenic
1047961308 8:130014032-130014054 CCTTCCTGACTGAAGGTCTTGGG + Intronic
1048061587 8:130924612-130924634 CCATCCCTACTGGATGCAATAGG + Intronic
1048537503 8:135311292-135311314 CCATCCCTATTGGAGTTAATAGG - Intergenic
1050313713 9:4379297-4379319 CCTTCCCTACTGAGGTTAATAGG + Intergenic
1051669360 9:19494558-19494580 CCTTCCCTATTGAGGTTAATAGG - Intergenic
1051811607 9:21055569-21055591 CCATCCCTACTGATCTTAATAGG + Intergenic
1053285631 9:36848046-36848068 CCTTCCCTACTGGAGGTGACAGG + Intronic
1054827029 9:69583376-69583398 CCTTCCCTATTGAGGTTAATAGG + Intronic
1056193212 9:84205263-84205285 CCTTCCCTATTGAGGCTAACAGG - Intergenic
1056203064 9:84295135-84295157 CCCCCCCTACTGAAGTCAATAGG + Intronic
1056210196 9:84358137-84358159 CCTTCCCTACTGAAGCTAATCGG - Intergenic
1057955172 9:99401538-99401560 TCATCCCTACTGAAGTCAATAGG - Intergenic
1060052554 9:120387563-120387585 CCTCCCCTACTGAGGTTAATAGG + Intergenic
1060920235 9:127415239-127415261 CCCTCCCCACTGAAGGCAAATGG - Intergenic
1186690298 X:11968347-11968369 CCATCCCTACTGAAGTCAATAGG - Intergenic
1186746239 X:12572619-12572641 CCTCCCTTACTGCATGTAATGGG - Intronic
1187346290 X:18467517-18467539 CTGTCCCTATTGAAGTTAATAGG + Intronic
1187697639 X:21937804-21937826 CCTTCCCTACTGAAGTTAATAGG + Intergenic
1188515004 X:30975841-30975863 CCTATCCAACAGAAGGTAATAGG + Intergenic
1188672233 X:32894238-32894260 CCTTCGCTATTGAGGGTTATAGG - Intronic
1191970901 X:66815280-66815302 CCTGCCCCAGTGGAGGTAATGGG + Intergenic
1192325939 X:70132167-70132189 CCTACCCAACTGAAGGTTAATGG + Intergenic
1192559047 X:72113398-72113420 CCATCCCTACTGAAGTCAATAGG - Intergenic
1192939040 X:75893454-75893476 CCCTCCCTACTGGAGGTTTTTGG + Intergenic
1194464731 X:94219463-94219485 CCATCCCTACTGAAGTTAATAGG - Intergenic
1195324540 X:103747569-103747591 GCTGCCCTGCTGAGGGTAATTGG + Intergenic
1195991204 X:110684047-110684069 CCTTCCCTACTGAGGTTAATAGG + Intronic
1196438098 X:115692974-115692996 GCTTCCCTACTGAGGTTTATAGG - Intergenic
1198758542 X:140006410-140006432 CCATCCCTGTTGAAGTTAATAGG + Intergenic
1198780215 X:140227182-140227204 CCATCCCTGTTGAAGTTAATAGG - Intergenic
1199984888 X:152943388-152943410 CCTTTCCTTCTGAGTGTAATTGG - Intronic
1200933161 Y:8715397-8715419 CCTTTCCTACCGAAGGCAAGAGG - Intergenic