ID: 956344934

View in Genome Browser
Species Human (GRCh38)
Location 3:68268284-68268306
Sequence GCACCATTTCAGTTTAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 107}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956344934 Original CRISPR GCACCATTTCAGTTTAAAGG AGG Intronic
901614951 1:10531357-10531379 GCAGCATTTCTGTTTGAAGAGGG + Intronic
904105153 1:28074225-28074247 CCACCATTTCAATTTAAATAAGG - Intronic
907529903 1:55084708-55084730 GCACCATTTCCATTTACGGGGGG + Intronic
908973634 1:69868998-69869020 GCAGCATTTAAGTTAAAATGAGG - Intronic
910479587 1:87643792-87643814 TCACCATTATAGTTTTAAGGTGG - Intergenic
919053962 1:192545625-192545647 TTACCATTTTATTTTAAAGGTGG - Intergenic
1065076656 10:22086594-22086616 ACACCATTTTAGTTTATAGATGG - Intergenic
1066575992 10:36825523-36825545 GCTCCATTTTAGTTTAATGCAGG + Intergenic
1068337438 10:55653614-55653636 ATAACATTTCAATTTAAAGGAGG - Intergenic
1070274612 10:74993671-74993693 GTACTATTCCAGATTAAAGGAGG - Intronic
1079393406 11:20041486-20041508 GCACCATTACAGTTTGATTGGGG + Intronic
1080866101 11:36196580-36196602 GCATCATTCCAGGTTAAAGCAGG - Intronic
1081497318 11:43628008-43628030 GAACCATTTCTGTTTATAAGAGG - Intronic
1084902959 11:72323674-72323696 GGACCATTCCAGATTAAAGAAGG + Intronic
1087368967 11:97256964-97256986 ACACCAGTTCACTTTAAAGTGGG + Intergenic
1087769525 11:102192788-102192810 GCACCATTTAAGTTTAACTTTGG + Intronic
1090200142 11:124848235-124848257 GCCCCATTTCTGATTACAGGAGG + Intergenic
1092995644 12:13947935-13947957 GAACAATTTCAGTTTAAAAATGG - Intronic
1094633742 12:32203588-32203610 GGCCCATTTCGGATTAAAGGAGG + Intronic
1095663462 12:44765814-44765836 GACTCATTTCAGTTTAAAGATGG - Intronic
1100037568 12:90271730-90271752 GCATCATTTCAGTGTAATTGAGG + Intergenic
1100340392 12:93674062-93674084 GCACAATTTCAGATTACAGAGGG + Intergenic
1111459937 13:88525929-88525951 GCACAGTTTCATTATAAAGGTGG - Intergenic
1113004874 13:105688977-105688999 CCAGCATTTCAGTGTGAAGGAGG - Intergenic
1118153432 14:63214378-63214400 GCACCATTACAGCATAAAGAAGG - Intronic
1119986121 14:79139829-79139851 GCAGCATTTAATTTTAAAGGTGG - Intronic
1120493096 14:85201637-85201659 ACATCATTTTATTTTAAAGGAGG + Intergenic
1120548402 14:85839272-85839294 GCACCCCTTCATGTTAAAGGAGG - Intergenic
1120549971 14:85858450-85858472 GCAGCATCTCATTTTAAGGGAGG + Intergenic
1123153711 14:106205363-106205385 CCACCAGTTCAGTTTAGAAGGGG + Intergenic
1125182962 15:36898181-36898203 GCAACATTTCAGGTGACAGGTGG - Intronic
1132024569 15:98394087-98394109 GGGCCATTTCTTTTTAAAGGAGG - Intergenic
1133563452 16:6970765-6970787 GACCCAATTCAGGTTAAAGGGGG - Intronic
1135909479 16:26546041-26546063 GCACCATAGCACATTAAAGGGGG + Intergenic
1140190841 16:72814758-72814780 GCAGCATTTCATGTTAAAGCAGG - Intronic
1140579944 16:76218182-76218204 CCACCATCCCAGTTTAGAGGTGG - Intergenic
1143967717 17:10768652-10768674 TCACTCTCTCAGTTTAAAGGTGG + Intergenic
1144249151 17:13398108-13398130 GGATCATTTCAGTTTGATGGTGG + Intergenic
1145267850 17:21389082-21389104 GCACAACTGCAGTTTAAATGGGG - Intronic
1146703725 17:34984252-34984274 GAAATATTTCAGATTAAAGGAGG - Intronic
1146952596 17:36917068-36917090 GCATGATTTCCATTTAAAGGGGG + Intergenic
1147413787 17:40273804-40273826 GCACCATTTCGGATCACAGGTGG - Exonic
1149520182 17:57312798-57312820 GCACCATTATAGTTCCAAGGGGG + Intronic
1150037795 17:61822807-61822829 ACAAGTTTTCAGTTTAAAGGTGG + Intronic
1151750595 17:76035229-76035251 GCACCGTTTCATTTCAAAGAGGG + Intergenic
1158059477 18:53321176-53321198 GCACTATTTCAGATGAATGGGGG + Intronic
1161723810 19:5917345-5917367 GTGCCATTTCAATTCAAAGGAGG + Exonic
1165523000 19:36329260-36329282 CCACCAGTTTAGTTTAGAGGAGG + Intergenic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
929151436 2:38752045-38752067 TCACAATTTCAATATAAAGGGGG - Intronic
929362047 2:41103604-41103626 CAATCATTTCAGTTGAAAGGAGG + Intergenic
931072532 2:58669299-58669321 TCACCATTTCATTTTACTGGAGG - Intergenic
932660161 2:73644604-73644626 GCAACATTTCAGTGTCAAGCAGG + Intergenic
935012438 2:99148078-99148100 GAACTGTTTCAGATTAAAGGAGG - Intronic
936470299 2:112792645-112792667 GCACCATGACAGTTTACAGATGG + Intergenic
940801094 2:158133405-158133427 GCAAAATTTCAGTTACAAGGAGG + Intronic
944107983 2:196100115-196100137 GCACCATGTGATTTTCAAGGCGG + Intergenic
944799258 2:203221319-203221341 GCATCTTTTCAGTGGAAAGGTGG - Intronic
1175530563 20:59671971-59671993 GCCACATTTCAGAATAAAGGAGG - Intronic
1177202809 21:17977034-17977056 GCTCCATAACACTTTAAAGGAGG + Intronic
1178938118 21:36881832-36881854 GCACCATTTTACTTGAAAGGGGG + Intronic
1180633572 22:17246727-17246749 GCACCAGCTCTGTCTAAAGGGGG - Intergenic
951319909 3:21231913-21231935 GAACTATTTCAGTGTAAAAGTGG - Intergenic
952100761 3:30010465-30010487 GCACTGTTCCAGATTAAAGGTGG - Intergenic
953091065 3:39726502-39726524 TCCCCACTTCAGCTTAAAGGAGG - Intergenic
953206573 3:40835732-40835754 GCAGCATTTCATTGTAAAAGTGG - Intergenic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
956698239 3:71936692-71936714 GCTCCATTTCTGTTTAAATTGGG - Intergenic
957336859 3:78841345-78841367 GGACCATTTGGGCTTAAAGGAGG + Intronic
957807266 3:85164822-85164844 GCACGATTTTAATTTAAAAGTGG - Intronic
966213606 3:177478326-177478348 GCACTATTACAGTCTAAAGAGGG - Intergenic
974242686 4:59271418-59271440 CCACCATTTCAGTCTAAAGTAGG + Intergenic
976114004 4:81707391-81707413 TGTCCATTTCAGTTTTAAGGAGG + Intronic
980142840 4:128941908-128941930 GCACCATTGCAGTTCAGTGGGGG - Intronic
980873994 4:138642096-138642118 GCACCATTGCAGTAAAAAGAAGG - Intergenic
982918602 4:161246100-161246122 TCACCCTTTCAGTTTAAAGTAGG - Intergenic
983145027 4:164202920-164202942 TCACCATTTTGGTTTAATGGTGG - Intronic
986816606 5:11419404-11419426 GCATCATTTGAGTTTAAACTGGG - Intronic
987900968 5:24011673-24011695 GTACCATATCAGATTAATGGTGG - Intronic
990109001 5:52300015-52300037 GAGCATTTTCAGTTTAAAGGTGG + Intergenic
993560551 5:89401982-89402004 ACATCATCTCAGTTTAAAAGTGG - Intergenic
995415937 5:111913273-111913295 GCACTACTTCATTTTAAAAGCGG + Intronic
995540876 5:113184980-113185002 TGACCCTTTCAGTTAAAAGGTGG - Intronic
998276313 5:140757328-140757350 GAACCATTTCAGATTAAATAGGG - Intergenic
998974939 5:147635241-147635263 ACACATTTTCAGTTCAAAGGTGG - Intronic
999481422 5:151951619-151951641 TCACCATCTCACTTTACAGGTGG + Intergenic
1001688304 5:173612694-173612716 TCACCATTACACTTTAGAGGTGG + Intronic
1005624237 6:27648286-27648308 GCAGCATTTCAGAGTAAAGCAGG + Intergenic
1006220855 6:32489951-32489973 CCACCATTTCACTTTAACGGTGG - Intergenic
1008346326 6:50431707-50431729 ACACCATATGTGTTTAAAGGTGG + Intergenic
1018164505 6:161080488-161080510 GCACCATTTCAAGCTAAAGTAGG + Intronic
1018214033 6:161509480-161509502 GCACCTGTGCTGTTTAAAGGAGG + Intronic
1021791975 7:24215165-24215187 GCCCCCTGACAGTTTAAAGGTGG + Intergenic
1023431514 7:40096385-40096407 ACACCATTACAGTTTAAATAAGG - Exonic
1026126565 7:67584762-67584784 GCACCATGACAGTTTACAAGTGG + Intergenic
1027262847 7:76477341-76477363 CCACCCTTTCAGTCTCAAGGAGG - Intronic
1027314229 7:76975450-76975472 CCACCCTTTCAGTCTCAAGGAGG - Intergenic
1027454387 7:78370345-78370367 GCACAATATCATTTTCAAGGTGG + Intronic
1028667207 7:93360359-93360381 CCACCATTTCATTTTGAAGATGG - Intronic
1028739854 7:94261452-94261474 GCACCATAGCAGCTTGAAGGAGG - Intergenic
1029823217 7:103164404-103164426 GCACAATTTTATTTTAAAGATGG + Intergenic
1030671578 7:112344032-112344054 AAACTATTTCAGATTAAAGGTGG + Intergenic
1034260526 7:149752667-149752689 GAACCATGACAGCTTAAAGGAGG + Intergenic
1048525298 8:135196965-135196987 GCAGCATTTCATTTTCATGGTGG + Intergenic
1051075430 9:13228233-13228255 TGAACATTTCAGTCTAAAGGGGG + Intronic
1051472040 9:17454732-17454754 GCACCATCTCTTTTTAAATGAGG + Intronic
1052191312 9:25666231-25666253 TCACCATTTAACTTTAAAGGAGG - Intergenic
1055440189 9:76329477-76329499 GAAACATTTCATATTAAAGGAGG - Intronic
1057067556 9:92069726-92069748 GCACCATTATACTTTGAAGGAGG - Intronic
1190443629 X:50501057-50501079 GCATTATTTCAGTGTAAATGTGG - Intergenic
1194260972 X:91695224-91695246 GCATGTTTTCACTTTAAAGGGGG - Intergenic
1196396451 X:115267656-115267678 TCAACATTTCCTTTTAAAGGAGG - Intergenic
1198273537 X:135079008-135079030 GCAGAAATTCAGTTGAAAGGAGG + Intergenic
1200846001 Y:7832793-7832815 CCACCAGTTCAGTTTACAAGAGG - Intergenic