ID: 956349423

View in Genome Browser
Species Human (GRCh38)
Location 3:68318307-68318329
Sequence ATAAAACTCAATCATCAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956349423_956349426 22 Left 956349423 3:68318307-68318329 CCTCTTTGATGATTGAGTTTTAT 0: 1
1: 0
2: 0
3: 23
4: 261
Right 956349426 3:68318352-68318374 AAGTCATTATATGCAGAAATTGG 0: 1
1: 1
2: 2
3: 22
4: 297
956349423_956349427 26 Left 956349423 3:68318307-68318329 CCTCTTTGATGATTGAGTTTTAT 0: 1
1: 0
2: 0
3: 23
4: 261
Right 956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG 0: 1
1: 0
2: 1
3: 14
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956349423 Original CRISPR ATAAAACTCAATCATCAAAG AGG (reversed) Intronic
901713837 1:11137195-11137217 AAAAAACTCAATCGCCAAAAAGG + Intronic
902353404 1:15876904-15876926 TTAAAATTAAATGATCAAAGTGG + Intronic
905151105 1:35928598-35928620 ATAAAACTCAATTTTGAAACAGG - Exonic
905925801 1:41748827-41748849 AGGAAACTCAAGCCTCAAAGAGG - Intronic
906998532 1:50825554-50825576 AGAAAACTCCATAATCATAGGGG + Intronic
907072298 1:51547500-51547522 ATAAAACTTAATTATCTAAGTGG + Intergenic
908406557 1:63819753-63819775 ATGAAACTTAATGACCAAAGAGG - Intronic
909470663 1:76024362-76024384 ATAAAACTCCAAGAGCAAAGAGG - Intergenic
910038214 1:82814365-82814387 ATAAAACTTAATCCTCATCGTGG - Intergenic
911808245 1:102239170-102239192 ATAAAACTAAATAATAAAAAGGG + Intergenic
912056142 1:105600487-105600509 ATAAACCTTAATAATCAATGGGG - Intergenic
912123599 1:106505557-106505579 ATGAAAAACAATCATAAAAGTGG + Intergenic
912819784 1:112857671-112857693 ATAAAACTCAAGCGTCAAGAGGG - Intergenic
916393429 1:164358738-164358760 ATTAGACTCAAGCATCAATGTGG + Intergenic
916681689 1:167110676-167110698 AGAAAACACAATCACCAAGGTGG - Intronic
916982064 1:170148598-170148620 CTAAATTTCTATCATCAAAGAGG - Intronic
917264338 1:173204304-173204326 ATAAAAATCAAGGCTCAAAGAGG + Intronic
917641000 1:176983078-176983100 GTGAAATTCAATGATCAAAGAGG + Intronic
917759932 1:178145607-178145629 ACAAAACTCAAAAATAAAAGTGG + Intronic
918775637 1:188626500-188626522 ATATAAATCAATCTTCATAGTGG - Intergenic
918840828 1:189536672-189536694 ATACTACTCAACTATCAAAGAGG - Intergenic
919337876 1:196263911-196263933 GTAAAACCAAGTCATCAAAGAGG - Intronic
921894389 1:220384208-220384230 ATAAAACTCACACACTAAAGAGG - Intergenic
922370462 1:224905634-224905656 ATAACACTTTATCATCAAAGTGG + Intronic
923821614 1:237449791-237449813 ATAAAATACAATCATCAATAGGG - Intronic
1065223575 10:23520566-23520588 AAAAAACTCAATCTGCAACGTGG - Intergenic
1065406667 10:25373656-25373678 AAAAAACTCAAAAATCAAAAAGG - Intronic
1066498111 10:35962090-35962112 ATAAAACTAACTCATGGAAGAGG - Intergenic
1066701380 10:38133300-38133322 ATAAAAAACAAGCAACAAAGTGG - Intergenic
1067703042 10:48587372-48587394 AGAAAACTCAGTAATCAAAGGGG - Intronic
1067828740 10:49597857-49597879 AAAAAACTAAAGCATCCAAGGGG + Intergenic
1068199305 10:53762704-53762726 AAAAAACTCACTCATCAATAAGG - Intergenic
1068663659 10:59649536-59649558 ATTAAACTCCTTCCTCAAAGAGG + Intergenic
1070455896 10:76614945-76614967 ATAATACACAATGATGAAAGGGG + Intergenic
1070939858 10:80335011-80335033 ATAGAACTGAAACTTCAAAGGGG + Intergenic
1074006766 10:109433877-109433899 AAAAAAATCAATCATGAAATAGG + Intergenic
1074066768 10:110022372-110022394 AAAAAACAGAACCATCAAAGAGG + Intronic
1074416866 10:113274258-113274280 ATAGAACTCACTCCTCAAAATGG + Intergenic
1075839687 10:125490096-125490118 TTCAAATTCAATCATCAAGGGGG - Intergenic
1077347126 11:2066611-2066633 ATAATACTGTATCATCACAGTGG - Intergenic
1077936034 11:6786355-6786377 GTAAAACCCAGACATCAAAGGGG + Intergenic
1078230923 11:9442219-9442241 ATAAAAGTCACTAATTAAAGAGG - Intronic
1079870200 11:25788548-25788570 ATAAAATAAAATCATGAAAGAGG + Intergenic
1079894961 11:26106991-26107013 TTCAAACTCAGTCATCATAGAGG + Intergenic
1080179578 11:29408194-29408216 ATAAAAGTAAATCAGCATAGCGG - Intergenic
1080654816 11:34250581-34250603 ATAAAACTTCATCCTGAAAGAGG + Intronic
1082554572 11:54546930-54546952 GTTAAACTCAACCATCAAAAAGG - Intergenic
1083281832 11:61631613-61631635 AAAAAATTCAGTCATCACAGTGG + Intergenic
1085014840 11:73167064-73167086 ATAAAGCCCAACCATAAAAGGGG + Intergenic
1087437295 11:98137177-98137199 ATCAAAAACAATTATCAAAGAGG + Intergenic
1087656434 11:100928873-100928895 AAAGAAGTCAATCACCAAAGGGG - Intronic
1087677590 11:101180732-101180754 ATAGTACTTAATCATCAGAGTGG + Intergenic
1087867539 11:103249687-103249709 ATAAAACACCAACATCAGAGAGG + Intronic
1088613254 11:111599404-111599426 AAAAAATACAATCATCTAAGTGG + Intergenic
1089166307 11:116479528-116479550 ATAAAACTCATTAACCCAAGAGG + Intergenic
1090235914 11:125146991-125147013 ATATCAATCAATCACCAAAGTGG - Intergenic
1091605814 12:1950439-1950461 CTAATTCTAAATCATCAAAGAGG + Intronic
1093617210 12:21241057-21241079 TTAAAAATCAATCATCAGACTGG + Intergenic
1094015196 12:25855533-25855555 ATATAACTGAATAATCTAAGGGG - Intergenic
1098601540 12:72337148-72337170 CTAAAACTCAAGCAGCGAAGTGG - Intronic
1099136734 12:78914176-78914198 ATAAAAGTAAATTTTCAAAGGGG + Intronic
1101062326 12:100985110-100985132 TTAAAACTCATTCAAGAAAGAGG - Intronic
1101614474 12:106322660-106322682 ATAAAACTCAATTCTCAATGTGG - Intronic
1102319272 12:111917418-111917440 ATAAAATAAAATCATTAAAGGGG - Intergenic
1102947507 12:117002334-117002356 TTAAAACTTAAACATGAAAGCGG + Intronic
1104105573 12:125655879-125655901 ATAAAACTCAATCATGACTTTGG + Exonic
1108364873 13:49700144-49700166 ACAAAACTCACTCTTTAAAGTGG + Exonic
1109819576 13:67635491-67635513 ATAAAACTCTACCAACAAAATGG - Intergenic
1110040205 13:70745310-70745332 ATAAAACTCAAATATCAGTGAGG - Intergenic
1110138318 13:72096758-72096780 ATAAAACTCCATATTAAAAGTGG + Intergenic
1113009299 13:105745334-105745356 TTAAAAATGAATCATTAAAGTGG - Intergenic
1113149506 13:107246756-107246778 ATAAAAAACAATCCTCAATGTGG - Intronic
1114721476 14:24887368-24887390 TTAAAATTGAATCATGAAAGTGG - Intronic
1115849714 14:37581253-37581275 ATAAAAATGGATCCTCAAAGAGG + Intergenic
1117447343 14:55817034-55817056 ATGAATATCAAACATCAAAGAGG + Intergenic
1118351949 14:64978523-64978545 AAAAACCTCAATTAACAAAGAGG - Intronic
1118573921 14:67222574-67222596 ATAAAACCCAAACATTAAATAGG - Intronic
1118589907 14:67393424-67393446 ACAAAAATCAATCATCATGGCGG - Intronic
1120375068 14:83694615-83694637 ATAAAAATCAATTGTTAAAGGGG + Intergenic
1121041053 14:90748157-90748179 ATAAAAAACAAACAGCAAAGTGG - Intronic
1121878235 14:97474625-97474647 ACAAAACACCATCATCCAAGGGG - Intergenic
1124017778 15:25892398-25892420 AAAAAACTCAGGAATCAAAGTGG + Intergenic
1125209098 15:37191197-37191219 ATAAAACAAAATCAAAAAAGGGG - Intergenic
1125262403 15:37842413-37842435 ATTAAACTCAAAGATAAAAGCGG + Intergenic
1126566310 15:50103957-50103979 ATCAAACAAAATCATCAATGGGG + Intronic
1126733679 15:51710298-51710320 ATAAAAATAAAGCATGAAAGAGG + Intronic
1127225367 15:56921742-56921764 ATAAAAAGCACCCATCAAAGAGG - Intronic
1127820233 15:62648436-62648458 ATAAAAATCAAACATCACAAGGG + Intronic
1128589104 15:68878778-68878800 AAAAAACTCAAGCATAAAGGGGG + Intronic
1129341773 15:74890898-74890920 AAAAAACTTAATTGTCAAAGAGG - Intronic
1130218014 15:81990843-81990865 ATAAAACTCAGGCATCAGAGTGG + Intergenic
1130240731 15:82186828-82186850 ACAAGCCTCGATCATCAAAGAGG - Intronic
1135395543 16:22129077-22129099 ATAAAAGTTAATCAAGAAAGAGG + Intronic
1136710995 16:32236687-32236709 AAAAAACAAAATCATCAATGTGG - Intergenic
1136756911 16:32692724-32692746 AAAAAACAAAATCATCAATGTGG + Intergenic
1136811198 16:33177651-33177673 AAAAAACAAAATCATCAATGTGG - Intergenic
1136817674 16:33287731-33287753 AAAAAACAAAATCATCAATGTGG - Intronic
1136824238 16:33344260-33344282 AAAAAACAAAATCATCAATGTGG - Intergenic
1136829304 16:33443031-33443053 AAAAAACAAAATCATCAATGTGG - Intergenic
1136942364 16:34599755-34599777 ATAAAAAGAAATCATCAAATGGG - Intergenic
1137066384 16:35849796-35849818 TAACAACTCTATCATCAAAGAGG + Intergenic
1137825516 16:51491139-51491161 ATAAAATCCAAGCATCACAGAGG - Intergenic
1138436941 16:57006622-57006644 AAAAACCTAAATGATCAAAGAGG - Intronic
1141599174 16:85114826-85114848 TTAAAACACAACCCTCAAAGGGG - Intergenic
1202989776 16_KI270728v1_random:620-642 AAAAAACAAAATCATCAATGTGG - Intergenic
1203059062 16_KI270728v1_random:953075-953097 AAAAAACAAAATCATCAATGTGG + Intergenic
1144496299 17:15748042-15748064 TTACAACTCAAGTATCAAAGAGG + Intronic
1150928303 17:69557296-69557318 ATTAAAATCAATGATGAAAGTGG + Intergenic
1152761571 17:82110465-82110487 CAAAAACTCATTCATCAACGGGG + Intronic
1154052985 18:10980866-10980888 ATGAAAGTCCATAATCAAAGTGG + Intronic
1154938175 18:21082638-21082660 ATAAAAAACAATCAACAAACAGG + Intronic
1155775548 18:29756240-29756262 ATGAAAAGCAATCATGAAAGAGG + Intergenic
1155807951 18:30195893-30195915 ATAAAACTCATTCGTTAAAAAGG - Intergenic
1156513648 18:37661834-37661856 ATAAATCCCAACCACCAAAGTGG + Intergenic
1159335477 18:67059092-67059114 ATAAAAATTAAACATCAAATAGG + Intergenic
1159576387 18:70183447-70183469 ATAAAACTCAGTCTTCAACCAGG + Intronic
1160249873 18:77193066-77193088 ATAAAACTCACCCAGCACAGTGG - Intergenic
1161139563 19:2639637-2639659 TTAAACCTCAACCATCCAAGGGG + Intronic
1163981807 19:20907737-20907759 AGCAAACTCACTCATCACAGTGG + Intergenic
1163982216 19:20911740-20911762 AAACCACTCATTCATCAAAGTGG + Intergenic
1168130362 19:54313949-54313971 ATGAACCTCACTCATCACAGCGG + Intergenic
926846348 2:17145156-17145178 ATAACATTCAATTATCACAGTGG - Intergenic
927133537 2:20080430-20080452 CTAAAACAAAATCATCAAAATGG + Intergenic
928036009 2:27823909-27823931 ATAAAATTCACTCTTTAAAGGGG + Intronic
929634680 2:43505971-43505993 ATAAAATTTAATGAGCAAAGTGG - Intronic
930343950 2:50154169-50154191 ATAAAAAATAATCTTCAAAGAGG - Intronic
931347875 2:61463015-61463037 ATAAGACTCCATCTCCAAAGGGG + Intronic
934073425 2:88407030-88407052 ATAAAACTGAGTCTTCAAAAAGG - Intergenic
934510246 2:94932893-94932915 AAAAAACACATCCATCAAAGTGG + Intergenic
935427089 2:102931367-102931389 CTAAAAATCCATCATCAAACAGG - Intergenic
938652314 2:133396259-133396281 ATAAATCTCAATGAACAAAGTGG + Intronic
938873532 2:135508080-135508102 ATAAAAATAAATCATGTAAGTGG - Intronic
938990631 2:136624859-136624881 GGAAAACGCATTCATCAAAGAGG + Intergenic
939167271 2:138653116-138653138 GTAAAACTCATTCACAAAAGTGG - Intergenic
940334209 2:152508342-152508364 ATAAAACCTAATAATCAAACAGG + Intronic
941691433 2:168504112-168504134 ATAAAAGTAAATCATCAGGGTGG + Intronic
942044565 2:172092441-172092463 ATAAAACATAATGATCAGAGAGG - Intergenic
943193665 2:184715323-184715345 ATAAAACTCAGTCACAAATGTGG - Intronic
943437120 2:187879890-187879912 ATAGTACTCAATTAACAAAGGGG - Intergenic
943448002 2:188013566-188013588 ATAAGAGGAAATCATCAAAGGGG + Intergenic
943608366 2:190002812-190002834 AGAAAACCCAAACATCAAACAGG - Intronic
944661562 2:201925810-201925832 ATAAAAGTAAAACATCAAAAAGG + Intergenic
944723720 2:202448754-202448776 ACAAAAATCAGTCATTAAAGAGG - Intronic
945367311 2:208971249-208971271 ATAAAACTGAATAATAAAAAGGG + Intergenic
945549807 2:211207024-211207046 ATACAACTTAACCATCACAGAGG + Intergenic
946269927 2:218582832-218582854 TAAGAACTCAGTCATCAAAGAGG - Intronic
946822534 2:223645167-223645189 TTAAAACTCAAGCAGAAAAGTGG + Intergenic
947021778 2:225685377-225685399 ATAAAATTCAATTATAAAAAAGG - Intergenic
947324968 2:228964066-228964088 ATAAAAATTAATAATGAAAGAGG + Intronic
948592120 2:239057516-239057538 AGAAAACAGAATCTTCAAAGAGG + Intronic
1169416563 20:5422165-5422187 ATACTACTCAGTCATCAAAAAGG + Intergenic
1169961916 20:11169790-11169812 AAAAAACACAATATTCAAAGAGG - Intergenic
1170444558 20:16412536-16412558 AGAAAACTTAATAATCAAGGTGG + Intronic
1173186753 20:40846208-40846230 ATAAAACTATCTCAGCAAAGAGG + Intergenic
1175409743 20:58759202-58759224 GTAAAACAGAATCATCAGAGTGG + Intergenic
1180372635 22:12057021-12057043 ATAAAAAAAAATCATCAAACAGG - Intergenic
1181735776 22:24880437-24880459 ATAAAACTGAAAAATCAAGGTGG - Intronic
1182215260 22:28711397-28711419 TGAAAACTCAGTCATCAAAAAGG + Intronic
1182666106 22:31961179-31961201 ATAAAACCCAATCATTAGACTGG + Intergenic
1183037762 22:35152983-35153005 ATAACACTGAATCATTAAATGGG + Intergenic
952117183 3:30196800-30196822 GTAAAACTCAATCACCCAAATGG + Intergenic
956153661 3:66270589-66270611 ATAAACCTCTATGATAAAAGAGG - Intronic
956245137 3:67174527-67174549 ATTAAACCCATTAATCAAAGTGG - Intergenic
956267291 3:67411417-67411439 AGAAAACTAAATGATCAAATAGG - Intronic
956349423 3:68318307-68318329 ATAAAACTCAATCATCAAAGAGG - Intronic
956687092 3:71840153-71840175 AGAATACTCAAGGATCAAAGAGG + Intergenic
959090569 3:101898340-101898362 AGAAAACTCAATTTTTAAAGTGG - Intergenic
959303266 3:104629552-104629574 ATAAAAATTAATTATGAAAGTGG + Intergenic
960523287 3:118680740-118680762 TTAAAACCTAATCATCAAGGTGG + Intergenic
962098239 3:132314686-132314708 TTATAACTGAATGATCAAAGTGG + Intergenic
963293728 3:143521486-143521508 ATTAAACTCATACATCAAAAGGG - Intronic
963460677 3:145611063-145611085 ATAAAAATCAAAAATCAAATAGG - Intergenic
963690692 3:148497907-148497929 AGAAGAATCAATGATCAAAGAGG + Intergenic
966463114 3:180199697-180199719 ATGAGTCTCAATCTTCAAAGGGG + Intergenic
967466259 3:189809420-189809442 ATAAAGCTCAAGTATAAAAGAGG + Intronic
967616498 3:191575319-191575341 ATAAAACTAAATAATTAAAAAGG + Intergenic
968409115 4:371159-371181 ATAAAACTCAATGAGCTAAATGG - Intronic
970105771 4:12581646-12581668 ATATAACTCATTCATTGAAGGGG + Intergenic
970789798 4:19843599-19843621 GTAAAACACAATTATCAAACTGG - Intergenic
971084135 4:23250571-23250593 GTAAAAGTCAATCATCATAAAGG + Intergenic
971967348 4:33577501-33577523 TTAAAACACAATCATCTAAGGGG - Intergenic
972200340 4:36707061-36707083 TAAAAAGTCAATCAACAAAGAGG + Intergenic
972557393 4:40194700-40194722 ATAAAACTGGAACATCAAAGTGG + Intronic
972695690 4:41443969-41443991 ATAAAACTGAATCATAGAAGAGG + Intronic
973010166 4:45063051-45063073 ATAAAAATCATTCCTCAAAATGG - Intergenic
974747939 4:66100755-66100777 ATAAAACTCAATGCTAAAAGTGG + Intergenic
975512154 4:75205840-75205862 CTCATACTCAAACATCAAAGAGG + Intergenic
976320999 4:83715538-83715560 ATAAAATTTAACCATCACAGGGG - Intergenic
977851654 4:101837715-101837737 ATGAAACTCAAACAACAAAATGG + Intronic
979269927 4:118747598-118747620 AAAAAATTCAAATATCAAAGAGG + Intronic
982552202 4:156816876-156816898 ATAAAACTGAATAGTCAATGTGG + Intronic
983681127 4:170354670-170354692 ATAAATATCAATCATTAAAGAGG + Intergenic
983746430 4:171205778-171205800 GTTGAACTTAATCATCAAAGTGG + Intergenic
984277021 4:177623385-177623407 ACATAACTCAATCATAAAATGGG - Intergenic
984843569 4:184091131-184091153 AAAAAACACCATCAGCAAAGTGG - Exonic
985013681 4:185610516-185610538 CTGAAACTCAGTCTTCAAAGAGG + Intronic
986319703 5:6620122-6620144 ATAAAATTCGATCATAGAAGAGG + Exonic
986464083 5:8004073-8004095 ATGAAACTTAATCCTCAATGTGG + Intergenic
986556200 5:9011899-9011921 ATCAAACTCAATGATCAAATGGG + Intergenic
986852150 5:11826461-11826483 ATATAACACAATGATCAAAATGG + Intronic
987377037 5:17245403-17245425 ATAAAACTCCATCTTCAAAATGG - Intronic
988695335 5:33616081-33616103 AGAAGACACAATCATGAAAGAGG + Intronic
988938983 5:36121564-36121586 ATAAATGTTAATAATCAAAGAGG + Intronic
989794535 5:45450409-45450431 ATAAAACTCAATCAGAAAGCTGG - Intronic
989840004 5:46052573-46052595 ATAATACTCAATCAAAAAAAAGG - Intergenic
990357473 5:54984667-54984689 AAATAACTCACTCTTCAAAGAGG - Intronic
990439201 5:55827666-55827688 ATGACACTCAATAATCAAATGGG - Intergenic
991211805 5:64114296-64114318 ATAAAAGTCAAACAGCACAGAGG + Intergenic
991327337 5:65449669-65449691 TTAAATCTCAAACATCAAAAAGG + Intronic
992858221 5:80885908-80885930 ATAAAACTCAATAACAAAAGAGG - Intergenic
994578047 5:101606333-101606355 AAAAAAATCAATTATCAAAATGG + Intergenic
996304929 5:122036213-122036235 ATAAAACTAGCTGATCAAAGTGG - Intronic
997453569 5:134002330-134002352 ATAAAACTAAATAATCAACAAGG + Intronic
998929339 5:147163290-147163312 GGAAAACTCAATCAGCAAAGAGG + Intergenic
1000255924 5:159538373-159538395 CTGGAACTCAAGCATCAAAGTGG - Intergenic
1000306418 5:159998834-159998856 ATAAAATTCAATAATAAAGGGGG + Intergenic
1001162230 5:169330275-169330297 ATAAAACTCAATAAAAAAATGGG - Intergenic
1001684508 5:173583493-173583515 ATGAAACCCAATAATCAGAGGGG + Intergenic
1003464586 6:6366436-6366458 ATAAAAGTCAATCTTCAAGATGG + Intergenic
1007049340 6:38810705-38810727 GTAAAACTAAAACATCAAACAGG - Intronic
1008342888 6:50388967-50388989 ATAAAATTTAATCGCCAAAGTGG - Intergenic
1008373773 6:50767939-50767961 CTAAAACTCTATCCTCAATGAGG - Intronic
1011919763 6:92558402-92558424 ATAAAAATCTCTCATCAAATGGG + Intergenic
1012114955 6:95285368-95285390 ATCAAAATCAATAATCAAAAAGG + Intergenic
1012970393 6:105723217-105723239 AGAAAACTCAATCAGGAAAGAGG + Intergenic
1013696871 6:112713336-112713358 AGCAAACTCAAGCATAAAAGAGG - Intergenic
1014301563 6:119688697-119688719 ATAAAACTGAATGATCAGATGGG + Intergenic
1015351887 6:132229440-132229462 ATAATTATCAATCATCAAATGGG - Intergenic
1016272809 6:142308709-142308731 ACAAAAATCAGTCATCAAAAAGG - Intronic
1017931375 6:158958588-158958610 CTAAAACTCAATCCTCAATGTGG - Intergenic
1018592296 6:165440434-165440456 ATAAAAATCAAGTAACAAAGGGG + Intronic
1019065899 6:169297393-169297415 AAAAAACTCAATTATCCAAATGG + Intergenic
1020864004 7:13533346-13533368 ATAGAAATCATTCCTCAAAGGGG + Intergenic
1021102928 7:16604650-16604672 TTAAAACTCAATCATCAGCTTGG + Intronic
1021505470 7:21379384-21379406 ATAAAAAGCAATTACCAAAGTGG + Intergenic
1021618525 7:22527730-22527752 AAAAAACTAAGTCATCAAAGGGG - Intronic
1022136130 7:27450202-27450224 ATAAATCTCAAAAATGAAAGAGG - Intergenic
1022259223 7:28688134-28688156 ATAAAGATCAAACTTCAAAGTGG - Intronic
1022694943 7:32695657-32695679 AAAAAACTAAGTCATCAAAGGGG - Intergenic
1022928123 7:35077177-35077199 AAAAAACTAAGTCATCAAAGGGG - Intergenic
1023479585 7:40619506-40619528 AAAAAATTCAATCATAAAATTGG - Intronic
1026880486 7:73904200-73904222 AGAAGACTGGATCATCAAAGTGG - Intergenic
1027569809 7:79851290-79851312 ATAAAACTCAAACAGCAATGAGG + Intergenic
1028374156 7:90128414-90128436 AAAAAACTAAGTCATCAAAGGGG + Intergenic
1029220719 7:98987921-98987943 AAAAAACACAATCATCTCAGAGG - Intronic
1029966586 7:104746924-104746946 ATATCACTGAATCATCAAGGAGG + Intronic
1036168806 8:6463395-6463417 AGAAAACTCAATCTAAAAAGAGG - Intronic
1037200243 8:16243363-16243385 ATAAAAATAATTAATCAAAGAGG - Intronic
1037629546 8:20641476-20641498 ATGAAACTCAAGTATTAAAGGGG - Intergenic
1039748508 8:40455219-40455241 ATCAATCTCAAACATTAAAGTGG + Intergenic
1040370763 8:46770713-46770735 AAAAAACTTAAACATCAAACAGG + Intergenic
1041611658 8:59857078-59857100 ATAGCACTAAATCATCAAAAAGG + Intergenic
1043243702 8:77971542-77971564 ATAAAACAAAATTATGAAAGAGG - Intergenic
1044322138 8:90814459-90814481 GAAATACTCAACCATCAAAGAGG - Intronic
1044544064 8:93439642-93439664 ATAAAAGCCCATCATCACAGTGG + Intergenic
1044843036 8:96354305-96354327 AAAAAATTCAAGCATCCAAGTGG - Intergenic
1045373669 8:101550110-101550132 ATAAAAATAAATAATAAAAGAGG - Intronic
1045448607 8:102295043-102295065 GTATACCTCAATCAGCAAAGTGG - Exonic
1045797133 8:106059401-106059423 ATAAAATTAAATCATTCAAGAGG + Intergenic
1046211734 8:111085169-111085191 TTAAAATGCAATCATCAATGTGG - Intergenic
1046598698 8:116292130-116292152 GAAAAACTCATTCATCCAAGTGG + Intergenic
1050152097 9:2627172-2627194 TTAAGACTTAATCATAAAAGAGG + Intronic
1050574678 9:6981375-6981397 ATAAAACACATTCATGTAAGTGG - Intronic
1051214885 9:14786458-14786480 ATACAAATAAACCATCAAAGTGG + Intronic
1052479574 9:29006530-29006552 ATAAAAATCATTAATAAAAGGGG + Intergenic
1052951788 9:34219646-34219668 ACAAAACTCAATGTTCACAGGGG - Intronic
1055770028 9:79706939-79706961 ATCAAATTCAAACATCAAATTGG - Intronic
1056198585 9:84252617-84252639 ATAAAACTTACTCATTAAACAGG + Intergenic
1057238706 9:93389636-93389658 ACAAAAAACAATCAACAAAGTGG - Intergenic
1058697196 9:107569562-107569584 ATAGAACTCAATCCTCTAATTGG - Intergenic
1059244612 9:112839024-112839046 ATAAAACTGAATAATCAAGTTGG + Intronic
1059542043 9:115140532-115140554 ATAAAGATCAATCATCAAATAGG + Intergenic
1062131505 9:134896573-134896595 ATAAAAGCTAATCTTCAAAGTGG + Intergenic
1186970931 X:14841745-14841767 ACACAACTGAATCATGAAAGTGG + Intergenic
1187493519 X:19774867-19774889 AAAAAAAGTAATCATCAAAGGGG + Intronic
1188465968 X:30481634-30481656 ATAAAATTATGTCATCAAAGTGG + Intergenic
1191794886 X:65010970-65010992 AAAAAACTAATTCACCAAAGAGG - Intronic
1194768329 X:97869628-97869650 AGAAAACGGAATCATCAAAAGGG - Intergenic
1196123441 X:112074843-112074865 AAACAGCTCAATCCTCAAAGTGG - Intronic
1196317868 X:114250542-114250564 TTCAAACTTAATCATCAATGTGG + Intergenic
1196915483 X:120530714-120530736 ATAAAAATTAATTTTCAAAGAGG - Intronic
1197221902 X:123922224-123922246 ATTAAACTCATTAATCAAGGTGG - Intergenic
1197438181 X:126457861-126457883 ATATTATTCAATCATGAAAGAGG + Intergenic
1198421695 X:136474874-136474896 ATAATACTCAATTATCCCAGGGG + Intergenic
1198603551 X:138311539-138311561 ATAAAAAGCAATAATGAAAGTGG - Intergenic