ID: 956349427

View in Genome Browser
Species Human (GRCh38)
Location 3:68318356-68318378
Sequence CATTATATGCAGAAATTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 225}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956349423_956349427 26 Left 956349423 3:68318307-68318329 CCTCTTTGATGATTGAGTTTTAT 0: 1
1: 0
2: 0
3: 23
4: 261
Right 956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG 0: 1
1: 0
2: 1
3: 14
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956349427 Original CRISPR CATTATATGCAGAAATTGGA AGG Intronic
901372978 1:8816848-8816870 CATTATTGGCTGAAACTGGAAGG - Intronic
905978257 1:42197154-42197176 CATTGTATGCAGAGTTTTGAGGG - Intronic
906050487 1:42867412-42867434 CATTATCTGCAGAAGATGGCAGG - Intergenic
906781562 1:48577232-48577254 TATTATATGCATAAGTTGAAGGG + Intronic
908139211 1:61166211-61166233 CATTATAGGTAGATATTGAATGG - Intronic
910638992 1:89439976-89439998 CATTATCTGCAGAAGATGGCAGG + Intergenic
912522822 1:110257990-110258012 GATTATAAGTAGAACTTGGATGG - Intronic
913133724 1:115866604-115866626 CAATGTATACACAAATTGGAAGG - Intergenic
914334018 1:146698937-146698959 CATTACATGCAGATGTGGGAGGG - Intergenic
915968878 1:160337856-160337878 CTTTATATGAATAAATTGTATGG - Intronic
916021750 1:160798698-160798720 CAGAATATGCAGACACTGGAAGG - Intronic
916772447 1:167925002-167925024 CATACTAAGCAAAAATTGGAGGG - Intronic
917122776 1:171659044-171659066 CATAATATTTAGAAATTAGATGG - Intergenic
920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG + Intronic
921289152 1:213638870-213638892 CCTTTTTTGCAGAAATTGGTAGG - Intergenic
921885594 1:220302085-220302107 CACAGTATGCAGAAATGGGAAGG - Intergenic
923966761 1:239150114-239150136 CCTTATCTGCAAAAAGTGGATGG - Intergenic
924365630 1:243290421-243290443 TTTTCTATGGAGAAATTGGAGGG - Intronic
924919104 1:248607480-248607502 CATAATTTGCATAAATTGAACGG - Intergenic
1063735903 10:8754067-8754089 AAATGCATGCAGAAATTGGAGGG + Intergenic
1064927122 10:20581753-20581775 AATTCTATGCAGAAAAGGGAGGG + Intergenic
1067333138 10:45340215-45340237 AGTTATATGCAGAAAATGGCAGG - Intergenic
1067364566 10:45613227-45613249 AATTATTAGAAGAAATTGGAGGG + Intergenic
1067762005 10:49055440-49055462 CATTATGTGCAGAATCTTGAAGG + Intronic
1068573931 10:58662301-58662323 AATTATCTGAAGGAATTGGAAGG + Intronic
1068611650 10:59066951-59066973 CACTCTATGAAGAATTTGGAGGG - Intergenic
1069312770 10:67059406-67059428 AATTAATTGCAAAAATTGGAGGG + Intronic
1069340210 10:67401260-67401282 CAGTATATGCTGAAACTGGGTGG - Intronic
1070159121 10:73854980-73855002 CATTATATCCAATAATGGGAGGG - Intronic
1070215478 10:74375126-74375148 ATTTATATGCAGAAAGTGTAAGG - Intronic
1072255948 10:93620453-93620475 CATTCTATGCAGTCATAGGATGG + Intronic
1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG + Exonic
1074643683 10:115418789-115418811 CAATATATTCAGAATGTGGAAGG + Intronic
1075606787 10:123817397-123817419 CATTATTTGCAGAAGATGGCAGG - Intronic
1078780033 11:14429437-14429459 CAAGATATGCAGAAATTCCATGG - Intergenic
1079063198 11:17267492-17267514 AATTAAATGCAGAAATTAGCCGG - Intronic
1089197871 11:116705554-116705576 CTTAATGTGCAGAAATTGAAAGG + Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1092550019 12:9487882-9487904 CAATATCTGGAAAAATTGGAAGG - Intergenic
1094749132 12:33385195-33385217 CATTAAGTGCAGAAATCTGAAGG - Exonic
1095334660 12:41010790-41010812 CATTTAATGCACATATTGGAGGG - Intronic
1095504180 12:42875370-42875392 AATCATATTCATAAATTGGAAGG - Intergenic
1097278984 12:57832877-57832899 ATTTCTATGCTGAAATTGGAGGG + Intronic
1097379949 12:58882799-58882821 CATTATTTGGATAAATGGGAGGG + Intronic
1098609925 12:72444025-72444047 CTTTATATGCAAAAAGAGGAAGG - Intronic
1098845794 12:75534208-75534230 CATTAAATGCAGTATTTGTAGGG - Intergenic
1099564427 12:84223841-84223863 CAATATATGCATGAATTGGTGGG + Intergenic
1102905684 12:116673662-116673684 CAGTTTATGCAGAAATTTCAAGG + Intergenic
1105234792 13:18539563-18539585 GTTTCTATGCAGAAATTGCATGG + Intergenic
1106452324 13:29894377-29894399 CCTTACATGCAGAAAGTGGCTGG - Intergenic
1106985291 13:35340192-35340214 CATTATTTGCAGTACTTAGAAGG + Intronic
1109081953 13:57914847-57914869 CATGATAAGTAGAAATTTGAGGG + Intergenic
1109856835 13:68141333-68141355 CATTATATGCAGAAATGACATGG + Intergenic
1111151614 13:84261192-84261214 CATTATATTAAGACATTGGCAGG + Intergenic
1111954655 13:94743100-94743122 CATTATAGGCAGAATATGGAAGG + Intergenic
1112946717 13:104937115-104937137 GAATATAAGCAGAAACTGGAAGG - Intergenic
1116519244 14:45830372-45830394 CCTTATATCCAGAAAATAGAGGG + Intergenic
1116609515 14:47049719-47049741 CATTCTATGCAGAATATGAAAGG - Intronic
1117409204 14:55435218-55435240 AATTATTTCCAGAAATTTGATGG + Intronic
1118505852 14:66410917-66410939 CATCATATGCAAATATCGGAAGG - Intergenic
1118540636 14:66820181-66820203 TATAATAAACAGAAATTGGAAGG - Intronic
1118850295 14:69577908-69577930 CAAGATATGTAGAAATTGGCTGG + Intergenic
1120253796 14:82092302-82092324 TAATATATGCAGAAATACGAAGG + Intergenic
1125000157 15:34761229-34761251 TATTTTATGCAGAAGTGGGATGG + Intergenic
1125435525 15:39640748-39640770 AATGACATACAGAAATTGGAAGG + Intronic
1126121144 15:45252702-45252724 CATTATAGTCAGGAATTTGAAGG + Intronic
1126126768 15:45301098-45301120 CATTATATTAAGAGATAGGAAGG - Intergenic
1126407828 15:48339952-48339974 CATTATATGAGAAAATTGAAAGG + Intronic
1127225802 15:56927269-56927291 CTTTATATGCAGAAAAAAGACGG - Intronic
1129302935 15:74636774-74636796 CTCTAAATGCAGAAATGGGAAGG - Intronic
1130500173 15:84491416-84491438 CATTATATTTAGAAATTAAATGG - Intergenic
1135106868 16:19657419-19657441 GTTTATCTGCAGAAATGGGAAGG - Intronic
1137349169 16:47695901-47695923 TATTATGTGCAGAACTGGGAAGG - Intronic
1138127591 16:54451818-54451840 CACTATATGCAGAAAGATGAAGG + Intergenic
1138425142 16:56926774-56926796 CTTTATACGCAGAATTTGTATGG - Intergenic
1139320000 16:66106678-66106700 CATTCTATGAAGGAATAGGATGG - Intergenic
1139999601 16:71012312-71012334 CATTACATGCAGATGTGGGAGGG + Intronic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1145399481 17:22519647-22519669 CATCATATGGAGATGTTGGATGG - Intergenic
1147817964 17:43223930-43223952 CACTCTCTGCAGAAGTTGGAAGG + Intergenic
1155865743 18:30962851-30962873 TATTATAAGCAGAAAGTGTATGG - Intergenic
1156224175 18:35086623-35086645 AATTATATGTAAAAATTGAAAGG - Intronic
1157108350 18:44796024-44796046 GATTAGAAGCACAAATTGGAAGG - Intronic
1157624062 18:49034333-49034355 CATTAGATTCATAAGTTGGAAGG - Intergenic
1159399438 18:67911578-67911600 CAGTATGTGCAGAAATTACATGG - Intergenic
1159768881 18:72524370-72524392 CATTATAACCAGAAATAGCATGG + Intergenic
1159993995 18:74943910-74943932 CATAATTTGTAGAAATTCGAAGG - Intronic
1162263777 19:9553177-9553199 CAGTTTATGCAGAAATTTGTAGG - Intergenic
1162591692 19:11596510-11596532 CATTAAATGCAAATATTGGCCGG + Intronic
1162883210 19:13676069-13676091 CAGTATCTGCAGACACTGGAAGG - Intergenic
1166239555 19:41480631-41480653 AGTTATATGAAGAAACTGGAGGG - Intergenic
925069382 2:954632-954654 CATTTAATACAGAAATAGGAAGG - Intronic
925321338 2:2971777-2971799 CATTCCAGGAAGAAATTGGAGGG - Intergenic
925378272 2:3404544-3404566 CATTATATGCATGAACTGGGAGG + Intronic
926014898 2:9442404-9442426 AAATATATGCAGAACTTGGGAGG + Intronic
928600007 2:32895191-32895213 CATTATATGGCAAAAGTGGAGGG + Intergenic
929388884 2:41444639-41444661 TGTTATATGCATAAATAGGATGG + Intergenic
930999898 2:57766941-57766963 CATAATCTGCAGAACTAGGATGG + Intergenic
932898260 2:75666423-75666445 TATTTTATAAAGAAATTGGATGG + Intronic
932967724 2:76497177-76497199 CATTATATGCAGATATTTCAGGG - Intergenic
936869381 2:117116252-117116274 GATGATTTCCAGAAATTGGATGG - Intergenic
936877314 2:117206434-117206456 AAATATAGGCAGAAATTGAATGG + Intergenic
938514998 2:131995062-131995084 GTTTCTATGCAGAAATTGCATGG - Intergenic
939507775 2:143070596-143070618 CAATAGATGGAGAAATTTGAGGG - Intergenic
939724397 2:145698235-145698257 CATGTTAAGGAGAAATTGGAGGG + Intergenic
941394086 2:164952846-164952868 TATTATATGCAGAAATTGAAGGG - Intronic
942074068 2:172340816-172340838 CATTTTATTTAGAAATTTGAAGG + Intergenic
942330923 2:174823095-174823117 CATTATGTGCAGAAATTTCTGGG - Intronic
942665183 2:178310105-178310127 CCTTCTATGAAAAAATTGGAAGG + Intronic
943804464 2:192105723-192105745 ACATATATGCAGAAAATGGAAGG + Intronic
943966943 2:194348151-194348173 TACTTTTTGCAGAAATTGGAGGG - Intergenic
945659724 2:212671022-212671044 CATTATAGGCAGTGAATGGAAGG - Intergenic
945763258 2:213941742-213941764 CAGTATATGAATAAAATGGAAGG - Intronic
948948505 2:241234122-241234144 CATTATTAGCAGATAATGGAAGG - Intronic
1169385012 20:5141338-5141360 CATTAGATGCACACATTGCATGG - Intronic
1169515154 20:6308963-6308985 AAATATACCCAGAAATTGGATGG + Intergenic
1169697764 20:8410094-8410116 CATTATATGCATATATTGTTGGG + Intronic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1174143857 20:48436633-48436655 AATTATATTGAGAAATTGGTAGG - Intergenic
1176778784 21:13167851-13167873 GTTTCTATGCAGAAATTGCATGG + Intergenic
1176894607 21:14361725-14361747 CATTATATGCAGTAATTCCATGG - Intergenic
1177104275 21:16935131-16935153 CATTATCTACAGAAATAGTAGGG + Intergenic
1177371629 21:20211422-20211444 CTTTATAAGCAGATATTGTAAGG - Intergenic
1177976423 21:27856978-27857000 GTTTCTATGCAGAAATTGCATGG + Intergenic
1178473348 21:32914904-32914926 CATTTTCTGCAGTGATTGGAAGG + Intergenic
1178708508 21:34893596-34893618 CATTATATGTAGATATTCAAAGG - Intronic
1182991039 22:34768031-34768053 TATTATTTTCAGAAAATGGAAGG + Intergenic
951246683 3:20349575-20349597 CAATACATGCAGAAGCTGGATGG + Intergenic
951869309 3:27342719-27342741 CACTAGATGCAGAAATTGTTAGG - Intronic
953655400 3:44847882-44847904 CATTATATGCAGCAATGCCAAGG - Intronic
955181263 3:56672753-56672775 AATTAAATGCCTAAATTGGAAGG - Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956444302 3:69310448-69310470 AATTATCTGCAGAAAGTGGAAGG + Intronic
956594975 3:70957676-70957698 CATGGTATGCAGAAATGTGATGG - Intronic
957263468 3:77930078-77930100 CATGATATGAAGGAATTGGATGG + Intergenic
957508064 3:81151463-81151485 CATGGGATGCAGAAATAGGATGG + Intergenic
958843251 3:99234235-99234257 CATTTCATGCTGAAAATGGATGG + Intergenic
960713935 3:120557775-120557797 CATGAAATGCAGAAATTAGGGGG + Intergenic
962491291 3:135896544-135896566 CATTGTGTGGAGAAACTGGAGGG + Intergenic
963402405 3:144816591-144816613 CATTGAATGCAGAATTTAGAGGG + Intergenic
963406324 3:144868259-144868281 CATTATGTGCAGAGATTACATGG - Intergenic
964804600 3:160594513-160594535 AATTAGATGGACAAATTGGATGG + Intergenic
965192576 3:165550343-165550365 GTTTTTATGCAGAAAGTGGAAGG + Intergenic
967006070 3:185383618-185383640 CAGTATGTGCAGAAATTACATGG - Intronic
967367951 3:188709153-188709175 CATTATATTCATGGATTGGAAGG - Intronic
969215789 4:5721292-5721314 TGATATATGCAGACATTGGAAGG + Intronic
970299903 4:14670176-14670198 GATTATCTGTAGAAATAGGATGG - Intergenic
973696367 4:53494701-53494723 GGTTAGATGCAGAAATTGGAGGG - Intronic
974639343 4:64608740-64608762 CATCATATAGAGATATTGGATGG + Intergenic
975268728 4:72403441-72403463 CAATATCTGCAGATATTAGATGG + Intronic
975286732 4:72630056-72630078 CATGATCTGCACATATTGGAAGG - Intergenic
977639185 4:99335871-99335893 CTTTATATGTAGATATTGGGTGG - Intergenic
978343639 4:107742684-107742706 CAAAATATGCAAAAATTGGCTGG + Intergenic
978623113 4:110654442-110654464 CATAAGATGCTGAAGTTGGAAGG + Intergenic
980888740 4:138791485-138791507 CATTTTATGGGGAAATTTGATGG - Intergenic
980945662 4:139318020-139318042 TATAATATTCAGAAAGTGGATGG + Intronic
982224768 4:153155402-153155424 AAGAATATGCAGAAATTGGAGGG + Intronic
983763792 4:171450644-171450666 CATTATGTGCAGAAATCACAAGG - Intergenic
987578345 5:19758341-19758363 AATTATATGCAGAAGATGGCAGG + Intronic
987631993 5:20485595-20485617 CATTATATGAAAAAATTAAAAGG - Intronic
988519371 5:31931936-31931958 CATTAATGGCAGAAGTTGGAAGG + Intronic
988635404 5:32978199-32978221 CGTTATATGAACAAATTGAAGGG - Intergenic
988644137 5:33075285-33075307 CATTATATCCAAAAACTTGAAGG + Intergenic
989264324 5:39455555-39455577 CAATAAATCCAGAGATTGGATGG + Intronic
989726483 5:44593162-44593184 CATTAAATACATAAATTTGAAGG - Intergenic
991261533 5:64673814-64673836 CATTAAATGGATAAATTGTATGG - Intergenic
991932657 5:71769150-71769172 CAGTATCTACAGAATTTGGAGGG + Intergenic
992499635 5:77329307-77329329 CATTATATGCCAAAAATGAATGG + Intronic
993010302 5:82474911-82474933 AATTATATGCAAATATTTGAAGG - Intergenic
993501344 5:88671306-88671328 CAAAATATGCAGAATCTGGAGGG + Intergenic
994458494 5:100046283-100046305 CATCATGTGGAGATATTGGATGG + Intergenic
994858641 5:105159217-105159239 CAATATATAAAGAACTTGGAAGG + Intergenic
994870780 5:105347741-105347763 CATTATAGGCAGCAATTCCAAGG - Intergenic
995153922 5:108886850-108886872 CATTAAATGCAGACATTGGTAGG + Intronic
995420503 5:111961659-111961681 CATTATATGCAGGAACTATAGGG - Intronic
995631452 5:114137586-114137608 TTTTATATGCAGAAATGGCATGG + Intergenic
998685581 5:144520618-144520640 AATTATATGCAGAAATTCCTAGG - Intergenic
999592249 5:153160822-153160844 CAGTATAGACAGAAATTGGTGGG + Intergenic
999653311 5:153788445-153788467 CATTTTATTCTGAGATTGGAGGG - Intronic
1005194266 6:23264831-23264853 CCTTATATGAAGAATTTAGAAGG + Intergenic
1008338675 6:50337423-50337445 AATTGTATACAGCAATTGGATGG - Intergenic
1008801860 6:55378244-55378266 CATTCTATGAAGAATTTTGATGG + Intronic
1009617507 6:66029432-66029454 TATTATACTCAGAAACTGGAAGG - Intergenic
1010063757 6:71655979-71656001 CATTACATTCAGAAATTGGTGGG + Intergenic
1010305105 6:74310589-74310611 CATTAACTGCACAAATTGTACGG - Intergenic
1010966780 6:82219324-82219346 CATTATAGGCATATATTGTAGGG - Intronic
1011736560 6:90316341-90316363 CATTATATTCAAAAACTAGAAGG + Intergenic
1012138847 6:95595161-95595183 TATTTTATGCAGAAAATGAAAGG - Intronic
1012789310 6:103673695-103673717 CATCATAGGCAAATATTGGAGGG + Intergenic
1015760965 6:136660032-136660054 CAGTATATGCATAAATTAAAAGG + Intronic
1016089365 6:139957071-139957093 TTCTATATTCAGAAATTGGATGG + Intergenic
1019803642 7:3106541-3106563 CATTCTAAGCAGAAAAGGGAGGG - Intergenic
1019803771 7:3107586-3107608 CATTCTAAGCAGAAAAGGGAGGG - Intergenic
1020049962 7:5074956-5074978 AATTATATGCAGTATTTGGCAGG - Intergenic
1020506398 7:8994263-8994285 CATTATATGCAAAAAGTATAGGG - Intergenic
1023954988 7:44878033-44878055 CTTTATATTTAGAAATAGGATGG - Exonic
1024325626 7:48107238-48107260 CATTATAGGCAGGACCTGGATGG + Intronic
1025919259 7:65895220-65895242 CATTATAAGCACAAGTTAGATGG + Intronic
1027869931 7:83694116-83694138 CAAAATACACAGAAATTGGAGGG + Intergenic
1029098103 7:98105381-98105403 GATTATATGCAGAATTGGTAAGG - Intergenic
1030442824 7:109609920-109609942 CAATATATGCAGAAACTCAAAGG + Intergenic
1035898601 8:3433097-3433119 CGTTTTATACAGAGATTGGAAGG + Intronic
1036458226 8:8928234-8928256 CTGAATATGTAGAAATTGGATGG + Intergenic
1037658355 8:20906522-20906544 TATTAGATGCAGGCATTGGAGGG + Intergenic
1038319892 8:26516146-26516168 CCTTATATGAATAAATTAGAGGG - Intronic
1038600309 8:28934627-28934649 AATAATATACAGAAATTGGCCGG + Intronic
1038845204 8:31222613-31222635 CATTTTATGAAGAAATTGGGGGG + Intergenic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1043028479 8:75102152-75102174 AATTATATTTAGAAGTTGGAAGG - Intergenic
1045239457 8:100386437-100386459 CATCAGATACAGAAAGTGGAAGG - Intronic
1046274131 8:111934767-111934789 CATTATATGCAGATCATGGTTGG - Intergenic
1046333531 8:112753423-112753445 CATTCTTTCCAGAAATAGGAAGG - Intronic
1047866840 8:129033956-129033978 CATCTTCTGCACAAATTGGAAGG + Intergenic
1050592808 9:7177687-7177709 CATTACATGAAGTAATTGGTTGG + Intergenic
1051556198 9:18385100-18385122 CATTACAAGCAAAATTTGGATGG + Intergenic
1051875501 9:21788804-21788826 CATTATACACAGAAATCCGACGG + Intergenic
1052138701 9:24949456-24949478 CAGTACATGCAGAAAGTGGGAGG + Intergenic
1054927331 9:70601847-70601869 CATGATAAGCAGAAAAGGGAAGG - Intronic
1055842399 9:80520415-80520437 CAATGAAAGCAGAAATTGGAGGG + Intergenic
1055871152 9:80881444-80881466 CAGCATATGCAGAAATTGTGCGG - Intergenic
1056236413 9:84599020-84599042 CATTGTTGGCAGAAATTGGGTGG + Intergenic
1056846838 9:90045725-90045747 CATTCTTTGCAGATGTTGGATGG + Intergenic
1056938059 9:90933018-90933040 CATTTTGTCCAGAATTTGGAAGG + Intergenic
1057238288 9:93384192-93384214 TATTATAGGCAGTAATTAGATGG - Intergenic
1058026738 9:100148360-100148382 CATTTTATGCAAAAATTTTAAGG + Intronic
1058846622 9:108966804-108966826 TAATATAGGCAGAAAATGGATGG + Intronic
1059118894 9:111623808-111623830 CCTTATATGAAGAAATTCAATGG + Intergenic
1185987917 X:4856573-4856595 CAATATATGAAGAAATTTGAGGG + Intergenic
1191626262 X:63274543-63274565 CATTTTATGAAGAAATTCAAGGG + Intergenic
1192730493 X:73798473-73798495 CATTATATAGAAAAATTAGAGGG + Intergenic
1194645148 X:96450302-96450324 GAATATATGAAGAAATGGGATGG + Intergenic
1195007620 X:100701708-100701730 CAGGATATGCATAGATTGGATGG + Intronic
1197052761 X:122079664-122079686 TATTATATGCAAAAGTTAGATGG + Intergenic
1197327417 X:125110629-125110651 TTTTTTCTGCAGAAATTGGATGG - Intergenic
1197636389 X:128919499-128919521 CATTATATGGGGAAATGGAAAGG + Intergenic
1198112313 X:133512679-133512701 CAATATCAGCAGGAATTGGACGG + Intergenic
1198701296 X:139400264-139400286 AGTTATCTGCAGAAAATGGAAGG - Intergenic
1198879884 X:141268578-141268600 AATTATATGCAAAATTTAGAAGG + Intergenic
1199363438 X:146949242-146949264 TTTTAAATGCAGAATTTGGAGGG - Intergenic
1199820571 X:151441744-151441766 CACTAAATGCACATATTGGAAGG - Intergenic
1201451182 Y:14116406-14116428 CATTACATGCAGCAATGTGAAGG - Intergenic