ID: 956350692

View in Genome Browser
Species Human (GRCh38)
Location 3:68332301-68332323
Sequence ATTTTCTCCTAGGAGTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 18193
Summary {0: 4, 1: 15, 2: 175, 3: 1670, 4: 16329}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956350692_956350694 -3 Left 956350692 3:68332301-68332323 CCATAAAACTCCTAGGAGAAAAT 0: 4
1: 15
2: 175
3: 1670
4: 16329
Right 956350694 3:68332321-68332343 AATATAGTAGAAAATCTTCACGG 0: 1
1: 0
2: 12
3: 81
4: 622
956350692_956350695 23 Left 956350692 3:68332301-68332323 CCATAAAACTCCTAGGAGAAAAT 0: 4
1: 15
2: 175
3: 1670
4: 16329
Right 956350695 3:68332347-68332369 TTGTTTTGACAATAATTTTTTGG 0: 1
1: 0
2: 7
3: 153
4: 1118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956350692 Original CRISPR ATTTTCTCCTAGGAGTTTTA TGG (reversed) Intronic
Too many off-targets to display for this crispr