ID: 956353375

View in Genome Browser
Species Human (GRCh38)
Location 3:68363495-68363517
Sequence CCAGCTAATACATGGAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956353368_956353375 16 Left 956353368 3:68363456-68363478 CCAATGTTCAAAGAGGCTGAATG 0: 1
1: 0
2: 1
3: 11
4: 174
Right 956353375 3:68363495-68363517 CCAGCTAATACATGGAAAATGGG 0: 1
1: 0
2: 1
3: 18
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956353375 Original CRISPR CCAGCTAATACATGGAAAAT GGG Intronic
902842476 1:19084017-19084039 CCAGTTCATAAATGGAAAACTGG - Intronic
905089447 1:35416998-35417020 CTAGCTGCTAAATGGAAAATGGG + Intronic
908033184 1:60023317-60023339 CAGCCTAATACATGGGAAATTGG - Intronic
908948316 1:69526967-69526989 GCAGGTGATACATGGAAAATAGG - Intergenic
909553103 1:76921539-76921561 GCAGCCATTACATGGATAATGGG + Intronic
910379836 1:86614325-86614347 ACAGACAATACCTGGAAAATCGG - Intergenic
911178197 1:94838443-94838465 CCAACTGAAACATAGAAAATGGG - Intronic
911193768 1:94973467-94973489 CCAGATAATTCAGGGCAAATCGG + Intergenic
911427924 1:97744701-97744723 CCATCTGATACATGTAAATTAGG - Intronic
911818830 1:102389782-102389804 CCAGCTAATACATATCAAAGTGG + Intergenic
912647524 1:111408350-111408372 CCAGTTAATAAATGTAAAAGTGG - Intergenic
914246609 1:145890948-145890970 ACAGCTAATAAATGGCAGATAGG + Intergenic
916873519 1:168942862-168942884 CTATCTAAAACATTGAAAATGGG + Intergenic
917391830 1:174545479-174545501 ACAGATAGTACCTGGAAAATCGG - Intronic
918934001 1:190896852-190896874 CCACCTAATTCATGAAAATTAGG + Intergenic
919529325 1:198696690-198696712 CCTGTTAATTAATGGAAAATGGG - Exonic
919775017 1:201188901-201188923 GCTGTTAAAACATGGAAAATGGG + Intergenic
920361721 1:205422401-205422423 CCATCTACTCCAGGGAAAATAGG + Intronic
921180496 1:212628014-212628036 CCAGCAAATCCAAGGAGAATCGG + Intergenic
921462239 1:215443261-215443283 CCAGCTAATATAATGATAATAGG - Intergenic
923532336 1:234821270-234821292 CCATTTAATAGGTGGAAAATCGG - Intergenic
1066211207 10:33240608-33240630 CTGGGAAATACATGGAAAATTGG - Intronic
1068482962 10:57618054-57618076 ATAGCTAAGACATGCAAAATGGG - Intergenic
1075734882 10:124658458-124658480 CCCACTCATACATGCAAAATGGG + Intronic
1077536714 11:3128132-3128154 CCATCCAATAGATGGAAAAACGG - Intronic
1081061689 11:38486601-38486623 TCAGGTAAAACATGGAACATGGG + Intergenic
1081139573 11:39481989-39482011 CCACCTAATACATTGGAATTAGG + Intergenic
1082611141 11:55298994-55299016 CTAAATAATACATGGAGAATTGG + Intergenic
1084566279 11:69930792-69930814 GCAGCAAATAGATGGATAATAGG - Intergenic
1086545434 11:87962238-87962260 CCAGGTAGTACATGTCAAATCGG - Intergenic
1086696582 11:89854202-89854224 TCAAATAATACATGGAGAATTGG - Intergenic
1086709576 11:89990288-89990310 TCAAATAATACATGGAGAATTGG + Intergenic
1088053609 11:105549756-105549778 CCAGCTCCTACATGGAAAGGTGG + Intergenic
1088080539 11:105906650-105906672 CCAGCTAATACGTGGTAAGCTGG + Intronic
1089754392 11:120675774-120675796 TGAGCTAATGTATGGAAAATAGG + Intronic
1089755432 11:120682692-120682714 CCATCTTATACATGGGAAGTGGG + Intronic
1090226657 11:125075939-125075961 CCAGGACATGCATGGAAAATAGG - Intronic
1090661516 11:128885556-128885578 CCAGAAAAGTCATGGAAAATAGG - Intergenic
1090898294 11:131000720-131000742 ACAGATAATACATTGAAAAATGG - Intergenic
1093504107 12:19844702-19844724 CAAGCTAGGACATGGAACATTGG + Intergenic
1095678706 12:44949568-44949590 CATGCTAATAAATGGCAAATTGG - Intergenic
1097604717 12:61739164-61739186 CCAGCTAATACATGGCAGTTGGG + Intronic
1098001516 12:65948811-65948833 GGACCTAATTCATGGAAAATTGG + Intronic
1107456564 13:40560915-40560937 CCATGTAATACATGTAGAATAGG - Intronic
1109078569 13:57868283-57868305 CCAGCTAATAACTTCAAAATGGG + Intergenic
1111630988 13:90846097-90846119 CAAGCTAATACAAGGTAACTGGG - Intergenic
1112922283 13:104628541-104628563 CTAGTTGATACATGAAAAATTGG + Intergenic
1113486637 13:110657635-110657657 CCAACTAATAAATGTAAAAGAGG + Intronic
1114389683 14:22293703-22293725 CCAACAAATCCATGGAAAGTAGG + Intergenic
1115425489 14:33254168-33254190 GAAGCTGCTACATGGAAAATTGG - Intronic
1115987621 14:39118437-39118459 CCATCTAAAACTTGAAAAATGGG - Intronic
1116697375 14:48194083-48194105 CCTGCTAGTACTTGGAAGATGGG - Intergenic
1118066694 14:62200327-62200349 CCATTTAATAAATGGAAAACTGG - Intergenic
1120089848 14:80318782-80318804 CTTTCTAATACATGGAGAATTGG + Intronic
1125005720 15:34814407-34814429 CAAGATAATAAATGGCAAATAGG + Intergenic
1125292035 15:38160269-38160291 CATGCTAATACATGAAAATTAGG - Intergenic
1127195645 15:56582929-56582951 CCAGCTACTACCTAGAACATGGG + Intergenic
1127446439 15:59067756-59067778 CCAGCTAATTCATGAAAAATTGG + Intronic
1128829800 15:70757461-70757483 CCAGCTAATATATGAAGAAGGGG - Intronic
1130194247 15:81764168-81764190 CCAGCTAAGAGATGGAAAGAGGG + Intergenic
1138007339 16:53350265-53350287 ACAGATCATACCTGGAAAATCGG - Intergenic
1139939320 16:70593126-70593148 CCAGTTAAAAAATGGACAATAGG - Intronic
1141411322 16:83835277-83835299 CCAGCCACTGCAAGGAAAATGGG + Intergenic
1141552406 16:84814997-84815019 CCAGCTACCACATGGCCAATTGG + Intergenic
1141849813 16:86637457-86637479 CAAGCAAATGCATGGAAAAGAGG + Intergenic
1142768965 17:2082920-2082942 TGAGTTAATACATGAAAAATGGG - Intronic
1143777275 17:9207812-9207834 ACAGCTAATATCTGAAAAATGGG - Intronic
1146548776 17:33762324-33762346 CCATCCAAAACATGGAGAATGGG - Intronic
1148533691 17:48419968-48419990 CCAGCATTTACATGGAAGATAGG - Intronic
1149715180 17:58782259-58782281 TGAGCTAAGACTTGGAAAATTGG + Intronic
1150634033 17:66900117-66900139 CCAGCCTGTGCATGGAAAATTGG + Intergenic
1153665622 18:7365579-7365601 CCAACTAAAGCATGGAATATTGG - Intergenic
1155063623 18:22250463-22250485 CCAGGTAAAACATGGCAAATAGG - Intergenic
1156211937 18:34953627-34953649 CCAGTTAATACATGCAGAATAGG - Intergenic
1157581996 18:48779042-48779064 CCAGTTTATAAATGGAAAACTGG - Intronic
1159856088 18:73589845-73589867 CCATAAAATAGATGGAAAATAGG + Intergenic
1165379243 19:35466426-35466448 CAAGCTAACATAAGGAAAATAGG - Intergenic
925650910 2:6088033-6088055 TCAGCCAATCCAAGGAAAATTGG + Intergenic
926056055 2:9774675-9774697 ACAGCTAACACGTGGAAACTGGG - Intergenic
926180014 2:10634162-10634184 CTGGCTGTTACATGGAAAATAGG + Intronic
928636942 2:33256383-33256405 CCAGCTGATACATGGCATTTTGG + Intronic
932307433 2:70714023-70714045 CCAGCTAATACCTGGATAAAAGG + Intronic
933495885 2:83049772-83049794 TAAGATAATACATGAAAAATTGG - Intergenic
937299952 2:120832989-120833011 CCAGGTCAGACATGGAAACTTGG + Intronic
940552363 2:155176085-155176107 CCAGTTAATATAAGGAAAAGTGG - Intergenic
941015186 2:160347966-160347988 CCGTCTAATGCATGGAAAATAGG + Intronic
941162385 2:162050601-162050623 GCAGCTAATATGTGGAAACTGGG - Intronic
941264148 2:163338596-163338618 CCAGCCAAGAAATGGAAAATGGG + Intergenic
942951818 2:181729982-181730004 CCAGCTACTTCATGGCAAATTGG - Intergenic
944783872 2:203047954-203047976 TCAGCTAAGAAATAGAAAATTGG - Intronic
947484154 2:230531929-230531951 ACAGCAAATACATGAAAATTAGG - Intronic
1168946339 20:1762026-1762048 ATATCTAATACATTGAAAATGGG + Intergenic
1172507922 20:35477686-35477708 CCATCTAGTACCTGGAATATAGG + Intronic
1181159297 22:20948079-20948101 ACATCTACTCCATGGAAAATGGG - Intronic
1182601932 22:31472233-31472255 TCATCTAATGCATTGAAAATTGG - Intronic
949621277 3:5814463-5814485 CCAGAAAATACATGGAAGAGAGG - Intergenic
952501864 3:33970522-33970544 ACAGACAATACCTGGAAAATGGG - Intergenic
954060699 3:48064279-48064301 CCAGCTAATCCATTGAATATAGG - Intronic
955051436 3:55414886-55414908 TCAGATAATGGATGGAAAATAGG + Intergenic
956083921 3:65589617-65589639 TCAGATAATAAATAGAAAATAGG + Intronic
956129653 3:66040883-66040905 CAAGCAAAGCCATGGAAAATTGG - Intergenic
956353375 3:68363495-68363517 CCAGCTAATACATGGAAAATGGG + Intronic
957835365 3:85581679-85581701 CTTGCTCATACATGGAAAACTGG + Intronic
958467127 3:94472321-94472343 CTAGCTAATAACTGCAAAATTGG - Intergenic
958864287 3:99483015-99483037 CCAGCCAATACTTGGAAGATAGG + Intergenic
960064270 3:113353961-113353983 CCTGATAATACATGGGACATAGG + Intronic
960136810 3:114113859-114113881 CCAGGTAGTACATGTAACATTGG + Intergenic
961740095 3:129027645-129027667 CCATGTAAAACATGTAAAATGGG + Intronic
963206900 3:142645742-142645764 CTAAATAATACATAGAAAATAGG + Intronic
963996923 3:151720420-151720442 CCAGATAGTAAATGGAAATTTGG - Intergenic
967392385 3:188969492-188969514 CCATTTAATACATGAAAAAATGG - Intronic
970798528 4:19944713-19944735 CCAACTCAAACATGGAAAATTGG + Intergenic
973341198 4:49006482-49006504 CCTGCTATTTCCTGGAAAATTGG + Intronic
974132346 4:57772206-57772228 CAAGATAATCCATGGAAATTTGG + Intergenic
974624643 4:64408223-64408245 CTAGCTAGAACATGGAAAAACGG + Intronic
975674106 4:76809760-76809782 CTAACTGATACAAGGAAAATGGG - Intergenic
975815681 4:78214495-78214517 CCAGCTAAAAAATTAAAAATGGG - Intronic
975853354 4:78596367-78596389 CCAGCTATTACATGGAATTGTGG + Intronic
976014233 4:80531407-80531429 CAAGCTAAAATATTGAAAATTGG - Intronic
976103498 4:81591239-81591261 CCATCTCATATAAGGAAAATTGG + Intronic
976513695 4:85939461-85939483 CCCTTTTATACATGGAAAATTGG - Intronic
977329557 4:95620445-95620467 TCCTTTAATACATGGAAAATAGG - Intergenic
978848686 4:113307293-113307315 CCTGCTGAGACATGGAAAAAGGG - Intronic
979469528 4:121078051-121078073 CAAACTAAAACAAGGAAAATCGG - Intergenic
980495687 4:133585882-133585904 CCAGCTTATAACTGCAAAATTGG + Intergenic
982389041 4:154844375-154844397 AAAGTTCATACATGGAAAATTGG + Intergenic
983920701 4:173341232-173341254 TCAGCTAATCTGTGGAAAATAGG - Intergenic
984528122 4:180881579-180881601 CCAAGTAATACAAGGAATATGGG + Intergenic
986973927 5:13372832-13372854 CAGACTAATACATGGAAAATGGG + Intergenic
989120094 5:37996666-37996688 TAAGCTATTATATGGAAAATGGG - Intergenic
990366321 5:55074393-55074415 ACAGCTAATAAATGGCAAAGTGG - Intergenic
990554934 5:56923327-56923349 CCAGCAAAAAGATTGAAAATGGG - Exonic
992508811 5:77413566-77413588 CTAGCTAACATTTGGAAAATGGG - Intronic
992873472 5:81028914-81028936 CCAGATGGTACCTGGAAAATTGG + Intronic
995073904 5:107958755-107958777 CTGCCTAATACATGAAAAATGGG - Intronic
995074637 5:107967845-107967867 CCACATGATACATGGAATATAGG - Intronic
995271086 5:110220302-110220324 GCAGCTTCTTCATGGAAAATTGG - Intergenic
996272287 5:121621076-121621098 TCATCTACAACATGGAAAATTGG + Intergenic
997660998 5:135589573-135589595 CCACCAAATACACTGAAAATGGG - Intergenic
999784811 5:154881502-154881524 CCAGGTAATAGAAGGAAAAAGGG + Intergenic
999866122 5:155702213-155702235 CCAGGTAATAAATGGAATATTGG - Intergenic
1000951139 5:167484738-167484760 AGATCTAATACATGGGAAATTGG + Intronic
1001234810 5:170020514-170020536 TGAACTAATACATAGAAAATAGG - Intronic
1007670918 6:43552915-43552937 ACAGCTAATAAATGGCAAAATGG - Intronic
1010062420 6:71638705-71638727 ACAGGTAGTACATGAAAAATGGG + Intergenic
1010152650 6:72752705-72752727 ACAGCCAATCCATGTAAAATAGG + Intronic
1011027185 6:82881904-82881926 CCAGCTAATACCTGGCATATTGG + Intergenic
1011507727 6:88066858-88066880 TCACCTAATATATGGAAAATAGG - Intergenic
1012697848 6:102412064-102412086 AAAGCTAATAAAAGGAAAATGGG + Intergenic
1012831996 6:104215881-104215903 CCATCTAATACAATTAAAATTGG + Intergenic
1013211969 6:107995099-107995121 CCATCCAATAAATGGAAACTAGG - Intergenic
1014588738 6:123234818-123234840 CCTGCTGATACATGAAAAGTGGG + Intronic
1015262067 6:131249493-131249515 CCTTCTAATCCATGGGAAATAGG + Intronic
1015589292 6:134807209-134807231 CAGGCTCAGACATGGAAAATGGG - Intergenic
1015870216 6:137768760-137768782 ACAGCTAATACGTGGTGAATAGG + Intergenic
1016500289 6:144713255-144713277 CCAGCTAATATATGCAATACAGG - Intronic
1016686876 6:146891847-146891869 CCAACAAATACTTGGATAATTGG - Intergenic
1022734040 7:33059636-33059658 CCAATTAATAGATGAAAAATGGG + Intronic
1028723703 7:94062716-94062738 ACATCTAATACAAGGAAAAGGGG + Intergenic
1030526508 7:110660993-110661015 ACAGATGATACCTGGAAAATCGG - Intergenic
1030694355 7:112568701-112568723 ACAGCTAATGCCTGGCAAATGGG - Intergenic
1031658688 7:124392960-124392982 CAAACTAATACATGTAAAACTGG - Intergenic
1033786773 7:144740994-144741016 CCAGTTTATATATGGAATATAGG + Intronic
1034593556 7:152165317-152165339 GAAGCTAATACTTGAAAAATGGG - Intronic
1035886985 8:3302009-3302031 CCACCTAAAACAATGAAAATAGG - Intronic
1037003903 8:13752812-13752834 CCAGATAATACATGGAATCTTGG + Intergenic
1039281496 8:35990056-35990078 ACAGATGATACCTGGAAAATTGG - Intergenic
1040840222 8:51777115-51777137 CCATTTAATATATGCAAAATGGG + Intronic
1041318386 8:56587973-56587995 CTAGCTAATAAATGAAAAATAGG - Intergenic
1042302497 8:67300104-67300126 TCAGCTAGTATATGGAAACTGGG - Intronic
1043246090 8:78003524-78003546 CCACATAATACATGGTAAACCGG + Intergenic
1044860332 8:96516810-96516832 CCAACTAACAAATGGAAAAGGGG - Intronic
1048005150 8:130413126-130413148 ACAGCTAATAAATGGAACCTAGG + Intronic
1048943310 8:139421835-139421857 CCAGCTAATTCATGGAACCGTGG - Intergenic
1050446497 9:5728418-5728440 ACAGATGGTACATGGAAAATCGG - Intronic
1050810136 9:9734975-9734997 CCAGCAAAAACCTGAAAAATGGG - Intronic
1052360814 9:27554659-27554681 ACTGCCAATACATGAAAAATTGG - Intronic
1053612147 9:39724959-39724981 CCAGCCAGCACATAGAAAATAGG + Intergenic
1053637668 9:40029598-40029620 CAAGCTATTATATGGAAAATTGG - Intergenic
1053870180 9:42482952-42482974 CCAGCCAGCACATAGAAAATAGG + Intergenic
1054086109 9:60746197-60746219 CCAGCCAGCACATAGAAAATAGG - Intergenic
1054241371 9:62617434-62617456 CCAGCCAGCACATAGAAAATAGG - Intergenic
1054555499 9:66651957-66651979 CCAGCCAGCACATAGAAAATAGG - Intergenic
1055343608 9:75311279-75311301 CCAGCTAATGAAAGGAAGATGGG - Intergenic
1055551751 9:77438010-77438032 CAAGCTTCTACATGAAAAATGGG + Intronic
1056565224 9:87766020-87766042 CCCCCAAATACATGGAAATTAGG + Intergenic
1061361469 9:130144959-130144981 CTGGCTAACACATGGCAAATAGG - Intergenic
1185801957 X:3019357-3019379 ACAGGAAATACATAGAAAATTGG + Intronic
1186353318 X:8762835-8762857 CTGGTTAATTCATGGAAAATGGG + Intergenic
1186620259 X:11233126-11233148 CTGGTTAATTCATGGAAAATGGG - Intronic
1186794595 X:13032262-13032284 CTGGTTAATTCATGGAAAATGGG + Intergenic
1188555067 X:31402010-31402032 CCATTTTATAGATGGAAAATAGG + Intronic
1190500707 X:51075243-51075265 CCAGCTATTACTTGGCATATGGG + Intergenic
1192888114 X:75358967-75358989 CCTGGTAATACATGGACAAGGGG - Intergenic
1193588191 X:83353540-83353562 CCAGCTAATTTTTGGAAAAGGGG + Intergenic
1193684018 X:84555796-84555818 ACAGATGATACCTGGAAAATCGG + Intergenic
1194969753 X:100330257-100330279 CCTTTTAATACATGGAAAAGAGG - Intronic
1195208264 X:102625489-102625511 GCAGCTACTCCATGGAAAAGTGG - Intergenic
1195495486 X:105527676-105527698 CCACTAAATACATGGCAAATTGG + Intronic
1195932879 X:110096563-110096585 ACAGACAGTACATGGAAAATTGG - Intronic
1196417503 X:115487198-115487220 ACTGCTAATAGATAGAAAATGGG + Intergenic
1196713784 X:118791902-118791924 CCAGATAACAAATGGAGAATGGG - Exonic
1197660476 X:129165782-129165804 ACAGCTCTTCCATGGAAAATAGG + Intergenic
1199111732 X:143943359-143943381 CCAGCTCATACACGGTAGATTGG + Intergenic
1199431738 X:147769054-147769076 CCAGTTAAAACATAGAATATTGG + Intergenic