ID: 956355447

View in Genome Browser
Species Human (GRCh38)
Location 3:68387181-68387203
Sequence GAAAGCAGGACTAAAAGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 220}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956355447 Original CRISPR GAAAGCAGGACTAAAAGTTC TGG Intronic
900660916 1:3783012-3783034 CAGAGCAGGACAAAAAGCTCCGG + Intronic
907024653 1:51104287-51104309 AAAAGCAGGACTTATAGTTCAGG + Intronic
908140787 1:61182727-61182749 GAAAACTGGACAAAAACTTCGGG - Intronic
909498057 1:76301928-76301950 GAAAGCATGACAAACAGTCCTGG - Intronic
912397871 1:109361099-109361121 GAAAGCAGTACTAAAAGATTTGG - Intronic
913071488 1:115302945-115302967 GAAAGCAGGGCTGAAAGTGGTGG - Intronic
914323243 1:146585562-146585584 AAATGCAGGACTAAAATTTGTGG + Intergenic
915730038 1:158046794-158046816 TAACTCAGCACTAAAAGTTCTGG + Intronic
916290932 1:163165574-163165596 GAATGCGGGACTAGAAGTTAAGG + Intronic
920563663 1:206957336-206957358 GAAGGCAGGACTAAGCCTTCTGG + Intergenic
920575776 1:207059331-207059353 CAAAGCAGGCCTAGAAGTGCAGG + Intronic
921579712 1:216881752-216881774 GAAAGGAGGATAAAAAGTTATGG + Intronic
922462773 1:225825889-225825911 GAAAGCAGGACTAGGGGTTAGGG - Intronic
924798819 1:247312106-247312128 GGAAGCAGAACTTAAAGATCGGG - Intronic
1063415787 10:5871601-5871623 GCAAGAAGGAAGAAAAGTTCAGG - Intronic
1066460991 10:35612037-35612059 GAAAGAAGGAGGAAAAGTTGGGG + Intergenic
1068953823 10:62804678-62804700 GAAGGCCGGACTACAAGTCCCGG + Intergenic
1071935605 10:90526831-90526853 GCCAGAAGGACTAAAAGTTTTGG - Intergenic
1073757265 10:106593901-106593923 GGAAGCAGGACTAAGACTCCTGG - Intronic
1075839761 10:125490897-125490919 TAAAGCAGGACTCAAAGTATAGG - Intergenic
1075910338 10:126119286-126119308 GAAACCAGGGCTCAAAGTTAAGG - Intronic
1077057848 11:604227-604249 GCATGCAGGACAAAAAGCTCAGG - Intronic
1078854859 11:15198862-15198884 GAAGGCAGGAGTAAAGGTTGTGG + Intronic
1080279411 11:30539495-30539517 CAAAGCAGGACTAAACCTTATGG + Intronic
1081120620 11:39260970-39260992 GAAAGCATGAGTCAAAATTCTGG + Intergenic
1082091942 11:48097360-48097382 AAAAGCAGGACTCACATTTCAGG - Intronic
1082672067 11:56046389-56046411 GAAGGGAGGAATAAAAGTTAAGG - Intergenic
1084960245 11:72712674-72712696 GGAAACAGAACTAAAAGTGCTGG - Intronic
1085117764 11:73945264-73945286 GTAAGCAGCAAAAAAAGTTCCGG - Intergenic
1091125347 11:133090769-133090791 GAAAGCAGAACTTAAAGATTGGG + Intronic
1092389785 12:8065995-8066017 GACAGCTGGAATCAAAGTTCAGG + Intronic
1092669358 12:10845514-10845536 GAAACCAGGATTAATAGTTTTGG + Intronic
1093749986 12:22787312-22787334 AAAAGCAGTACTAAGAGTTTGGG - Intergenic
1095132375 12:38559674-38559696 AAAAGCAGGAAAAAAAATTCTGG - Intergenic
1095418937 12:42005272-42005294 GCAAGCAGGATTCCAAGTTCTGG - Intergenic
1096723194 12:53539771-53539793 GAAAGCAGAACTACAAGACCAGG + Intronic
1098941528 12:76542244-76542266 GACAGAAGAACTAAAAGTACTGG - Intronic
1099745896 12:86704568-86704590 GAAAGAAGGACAAAAAGTCAAGG + Intronic
1099807859 12:87543041-87543063 GACATAAGGACTAAAAGTCCTGG + Intergenic
1101043260 12:100778433-100778455 GAATGCAACACTAAATGTTCTGG - Intronic
1101974257 12:109341714-109341736 GAAAGCAGGGATAAAACTTAAGG + Intergenic
1102517126 12:113457233-113457255 GGAGGCAGGACTTAAAATTCCGG + Intergenic
1105202367 13:18191316-18191338 GAAAGCAGGACTATCAGGGCTGG + Intergenic
1105774263 13:23642357-23642379 GAAAGCATGACTAACACTTATGG + Intronic
1107074438 13:36306984-36307006 GAAAGCAGGAGTGATAGTTGAGG - Intronic
1108252823 13:48583807-48583829 CAAGGCAGGACTAAAAGATGGGG - Intergenic
1109442217 13:62389984-62390006 GAACTCAGGACTAAAATTGCTGG - Intergenic
1109658303 13:65424065-65424087 AAACCTAGGACTAAAAGTTCTGG + Intergenic
1110419731 13:75292805-75292827 GAAAGCAGGGCTTAGAGTTAGGG - Intronic
1111070730 13:83163104-83163126 AAAAGAAGGACTGAAAATTCCGG - Intergenic
1111242447 13:85493210-85493232 AAAAGCAAAACTAATAGTTCAGG + Intergenic
1111945399 13:94659806-94659828 GAAAACAGGACTGAAAGGTCTGG + Intergenic
1112079232 13:95950082-95950104 GAAAGCAGAAGTCAAAGTACGGG + Intronic
1113017754 13:105847211-105847233 AAAAGCAGAACTACAAGGTCAGG + Intergenic
1114435315 14:22701821-22701843 GAAATTAGGAGTAAAAGTTTTGG + Intergenic
1114891850 14:26934580-26934602 GAAATCAGGATTAAAATTGCGGG + Intergenic
1115870772 14:37800286-37800308 GAAAGAAGAACTAATAATTCAGG + Intronic
1116565242 14:46437416-46437438 GGAAGTAGGACTGAAATTTCAGG + Intergenic
1116953376 14:50898856-50898878 GAGACCAGGCCAAAAAGTTCAGG + Intronic
1117053104 14:51881932-51881954 GAAACCAGGATTGAAAGTCCTGG - Intronic
1118081337 14:62364687-62364709 CAACACAGTACTAAAAGTTCTGG - Intergenic
1118495756 14:66306661-66306683 GCAAGCAGGACTAGGAGTTGTGG + Intergenic
1120207443 14:81601632-81601654 GAAGGTAGGACTGAAAATTCGGG - Intergenic
1120310294 14:82818305-82818327 GGAAACAGGAATAAGAGTTCAGG + Intergenic
1121216766 14:92254487-92254509 GAAATCAGGACAGAAAGTTCTGG + Intergenic
1124096448 15:26652879-26652901 GAAAGCAGGACTTAAACTTTAGG - Intronic
1125120378 15:36151125-36151147 GAAAACAGGTCAAAAACTTCAGG + Intergenic
1125332077 15:38592291-38592313 GAAAGCAGAATGAAAGGTTCCGG + Intergenic
1125921080 15:43526374-43526396 GAGAGCAGGAAGAAAAGTACTGG + Exonic
1125936458 15:43640511-43640533 CAAAGGAGGAATAAAAGTTAAGG + Intronic
1125949226 15:43737023-43737045 CAAAGGAGGAATAAAAGTTAAGG + Intergenic
1126349421 15:47729284-47729306 CAAAGCAGGACTTGAAGATCAGG - Intronic
1126550284 15:49921138-49921160 GGAAGCAGGACTAAATGTGGAGG + Intronic
1128903603 15:71447926-71447948 AAAAGAAGGACTAAAGGTACAGG + Intronic
1129827319 15:78642126-78642148 GAAAGCAAGACTGAGAGTCCTGG - Intronic
1134157325 16:11853997-11854019 GTAGGTAGGACTAAAGGTTCAGG + Intergenic
1135710712 16:24714664-24714686 GAAAGAAAGACTTAAACTTCTGG - Intergenic
1136108738 16:28051297-28051319 GAAAGCAGGGCTCCAGGTTCTGG + Intronic
1136547378 16:30963359-30963381 GAAAGCAGGAATACCAGATCAGG + Intronic
1138801268 16:60033099-60033121 CAAAGCAGGGATAAAAGTTCAGG - Intergenic
1139005009 16:62559257-62559279 GACACAAGGACTAAAATTTCTGG - Intergenic
1139313195 16:66044338-66044360 GAAATCAGAACAACAAGTTCAGG + Intergenic
1140010319 16:71125288-71125310 AAATGCAGGACTAAAATTTGTGG - Intronic
1141363688 16:83421898-83421920 GAAAGCAGGAAACAAAGTTTTGG + Intronic
1142694424 17:1625748-1625770 GGAGGCAGGAGCAAAAGTTCGGG + Intronic
1144386327 17:14751863-14751885 GAACGCAGGACAAAAAACTCGGG + Intergenic
1146960127 17:36967504-36967526 GACAGCAGGTCGAAAAGCTCTGG - Intronic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1149288564 17:55193363-55193385 GAAAGCAGGCAAAAAAGTTTGGG + Intergenic
1149436112 17:56634802-56634824 GAAAGGAGGAAGAAAAGTTTTGG - Intergenic
1149838476 17:59936431-59936453 AAAAGCAGGAAGAAAAGTTGAGG - Intronic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1152519287 17:80845913-80845935 GAAAGCAGAGCTCAAAGGTCTGG - Intronic
1153242066 18:3040051-3040073 TAATGCAGGAATAAAAGCTCAGG - Intergenic
1153439115 18:5097814-5097836 GAAAGAAAAACTAAAAGTTCTGG - Intergenic
1153939013 18:9960839-9960861 AAAAGAAGGACAAAAATTTCAGG - Intergenic
1153972868 18:10242362-10242384 GAAGGCTGGATTAAAAGTTTAGG + Intergenic
1156681479 18:39594345-39594367 GAAATGAGGACAAAATGTTCTGG - Intergenic
1158643507 18:59222100-59222122 GAAAGATGGAATGAAAGTTCTGG + Intronic
1159424943 18:68272843-68272865 GAAAGGAGAAATAAAAGTGCTGG - Intergenic
1164717185 19:30401361-30401383 GAAAGAAGGACTTCAAGATCCGG + Intronic
1166018037 19:39997888-39997910 TGTAGCAGGTCTAAAAGTTCAGG + Exonic
1167372155 19:49089562-49089584 GAAACCAGGACTAAGTGTTCAGG - Intronic
1167558722 19:50212207-50212229 GAGAGCTCGACTGAAAGTTCTGG - Intronic
1167786111 19:51637580-51637602 GAAAGCATTTTTAAAAGTTCTGG + Intronic
1168097006 19:54121687-54121709 GAAGGCAGGAACACAAGTTCAGG + Intronic
1168439323 19:56350179-56350201 TATAGCAGGACTAATAGTTATGG + Intronic
925465258 2:4102325-4102347 TAAAGCTGCACTAAAAGCTCAGG + Intergenic
927382652 2:22497025-22497047 GAGACCAGGAATAAAATTTCAGG + Intergenic
928900283 2:36310155-36310177 GAAAGCAGGAAAAAAAGTAGGGG + Intergenic
930842125 2:55859209-55859231 GACAGCATGCCCAAAAGTTCAGG - Intergenic
931692293 2:64845561-64845583 GAAAGCAGGACTGGAAATTAGGG - Intergenic
931975624 2:67640929-67640951 GAAAGCAGGACCAAGAAGTCCGG + Intergenic
932368412 2:71167541-71167563 GAAAGCAAGACTGAGAGTCCTGG - Intergenic
935617628 2:105102512-105102534 GAAAGGAGGAAGGAAAGTTCAGG + Intergenic
940682749 2:156806978-156807000 GAAAGCAGTTCTCACAGTTCTGG + Intergenic
941365708 2:164608613-164608635 TAATACAGGACTAAGAGTTCTGG + Intronic
942114098 2:172711260-172711282 GGAAGCAGATCTGAAAGTTCTGG - Intergenic
942345607 2:174999779-174999801 GAAAACAGGCCTAAAAGGCCGGG + Intronic
942415701 2:175757038-175757060 GAAAGCAGGGCTTAAAGATGTGG + Intergenic
942476023 2:176321718-176321740 GCCAACTGGACTAAAAGTTCTGG - Intronic
943772925 2:191738241-191738263 GCAAGATGTACTAAAAGTTCTGG + Intergenic
943893977 2:193329743-193329765 GAAACCAGAACTAAAAGATTTGG + Intergenic
944633571 2:201652843-201652865 GAAAGCAGGAAGGAAGGTTCTGG + Intronic
945909720 2:215635091-215635113 GACTGCTGGACTAAAAGCTCTGG + Intergenic
948729655 2:239954856-239954878 GAACGCAGGACTCACACTTCCGG - Intronic
1170397658 20:15945531-15945553 GAAAGCAGAACTCACATTTCTGG - Intronic
1172955223 20:38752092-38752114 GAAAACAGCACTGAAATTTCTGG - Intronic
1173248179 20:41350277-41350299 GAAAGCAAGACTCAGAGCTCTGG + Exonic
1174782997 20:53407206-53407228 GAAAGCAGGACTAGATATTGTGG - Intronic
1176715585 21:10346692-10346714 GAAAGCAGGACTATCAGGGCTGG - Intergenic
1178142327 21:29698417-29698439 GAAGGCAGGACTGAGAGCTCAGG + Intronic
1178310148 21:31523459-31523481 GGAAGGAAGACTAATAGTTCAGG + Intronic
1178669923 21:34581345-34581367 GAAAGGAAGACTACAAGTTAAGG + Intronic
1180602763 22:17033261-17033283 GAAAGCAGGACTATCAGGGCTGG + Intergenic
1182119448 22:27777230-27777252 GCAAGCAAGAAGAAAAGTTCTGG + Intronic
1182751919 22:32648506-32648528 GAAACCCGGACTTAAAGTTTTGG + Intronic
1182928111 22:34146353-34146375 GAAAGCAAGACAAAAATTTTTGG - Intergenic
1183854688 22:40623288-40623310 CAAAGCAGGCCAAAATGTTCAGG + Intronic
951937718 3:28040277-28040299 TAAAGCATGACTATAAATTCAGG + Intergenic
952052402 3:29400465-29400487 CTCAGGAGGACTAAAAGTTCTGG + Intronic
952145358 3:30526213-30526235 GAAAGCAGGACTGTTAATTCTGG + Intergenic
952535458 3:34304612-34304634 GAAAGCAGGGCAGAAAGATCTGG - Intergenic
953097075 3:39788677-39788699 GAATGCAGGTCCAAAAGTCCTGG + Intergenic
953369717 3:42377023-42377045 GTAAGCATGGCTAAAAATTCTGG - Intergenic
956355447 3:68387181-68387203 GAAAGCAGGACTAAAAGTTCTGG + Intronic
957389296 3:79541649-79541671 GAAAGCACAACTAAAATTTTGGG - Intronic
961990585 3:131185781-131185803 GTAAGAATGACTAAAATTTCTGG + Intronic
964729001 3:159845109-159845131 GAAGGCAGGAGTAAAGGGTCTGG - Intronic
964851214 3:161098248-161098270 CAAAGCAGCACTAAAAACTCAGG + Intronic
970082185 4:12299960-12299982 GAAAGGACGACTCAAAGTTGGGG + Intergenic
972722783 4:41717324-41717346 GAAAACAGCTCTAAAATTTCCGG + Intergenic
972918129 4:43905094-43905116 CAAAGCAGTCCTAATAGTTCAGG - Intergenic
973544207 4:51964240-51964262 GCAGGCAGGACTGAATGTTCTGG + Intergenic
974365258 4:60939660-60939682 GAAAGCTTGCCTAAAAGTTAAGG - Intergenic
974595165 4:64004634-64004656 GAAAGCAGGAATGAAAGTGAGGG - Intergenic
980877592 4:138677462-138677484 GAAATCAGGACTTAACGTCCAGG + Intergenic
981239465 4:142458974-142458996 GAAAGCAGGAACAAAAATTAAGG + Intronic
981715051 4:147744539-147744561 GAAAGCAGGACTGGAGGTTGGGG + Intronic
983913319 4:173264822-173264844 GAAAGCATGCCACAAAGTTCAGG - Intronic
986609703 5:9553945-9553967 GGAAGCAGAACTTAAAGATCTGG - Intergenic
988413590 5:30917175-30917197 GAAAGCAAGAGAAAAAGTCCTGG - Intergenic
989609319 5:43276334-43276356 GAAAGCAGGAGCAAGAGTTGGGG + Intronic
994791831 5:104237069-104237091 GAAAGCAGGACTAAAAGGCTTGG + Intergenic
995021420 5:107371312-107371334 AAAAGCAGGACTAAGAGATGAGG + Intergenic
995315870 5:110773626-110773648 CAAAGCAGGCCTAATAGCTCTGG - Intergenic
995720377 5:115125147-115125169 AAAAACAGGCCTAAAAGTTTTGG + Exonic
996375183 5:122797779-122797801 TAAAGCAGACCTAAAGGTTCAGG - Intronic
997421176 5:133767913-133767935 GAATGCAGGACTGAAAACTCCGG + Intergenic
998665874 5:144296993-144297015 GAAATCAGGTTTCAAAGTTCAGG - Intronic
1004195076 6:13496367-13496389 CAAAGCGGTACTAAAAGCTCAGG + Intergenic
1006719089 6:36138605-36138627 CAGAGCAGGGCTGAAAGTTCAGG - Intronic
1008312775 6:49997193-49997215 GAAAGCAGGACAATAATTTGAGG + Intergenic
1008765950 6:54915421-54915443 GAAAGCAGGAATAAAAGGGTTGG - Intronic
1009422764 6:63482229-63482251 GAAATTTGAACTAAAAGTTCAGG - Intergenic
1011419662 6:87157580-87157602 GTAAGCAGGATTAATAATTCTGG + Intronic
1011744813 6:90399248-90399270 GCAAGGAGGACAAAGAGTTCGGG + Intergenic
1015070067 6:129081647-129081669 GAAAAAAGGACTTAAACTTCTGG - Intronic
1015879906 6:137861688-137861710 GAAAGCAAGACAGAAAGATCAGG + Intergenic
1016481893 6:144491027-144491049 GAAAGCAGAACTTCACGTTCTGG + Exonic
1016845924 6:148568724-148568746 GAAGGCAGAACTAGAAGTTAGGG + Intergenic
1017574276 6:155784392-155784414 AAACTCAAGACTAAAAGTTCAGG - Intergenic
1020843793 7:13256734-13256756 GAAAACAGAAATGAAAGTTCTGG + Intergenic
1021014297 7:15513531-15513553 GAGAGTAGGAGTAAAAGCTCAGG - Intronic
1021389484 7:20074082-20074104 TAAAGCATGACTAAGAGTTGGGG - Intergenic
1021518295 7:21510806-21510828 AGAAGCAGGACTTAAACTTCAGG + Intronic
1022543382 7:31160497-31160519 GAAAGCAGGAATAAACAGTCAGG + Intergenic
1023743846 7:43303895-43303917 GTAAGCAGGACTCAAATCTCAGG + Intronic
1024883261 7:54113521-54113543 GGAGGCAGGACTGAAAGCTCAGG - Intergenic
1026770064 7:73190512-73190534 AAAAGAAGGAAAAAAAGTTCAGG + Intergenic
1027010931 7:74743896-74743918 AAAAGAAGGAAAAAAAGTTCAGG + Intronic
1027077110 7:75202144-75202166 AAAAGAAGGAAAAAAAGTTCAGG - Intergenic
1027784291 7:82560286-82560308 AAAAGCAGGACTGGAAATTCTGG + Intergenic
1028933993 7:96445306-96445328 AAAAGCAAGACAAAAAGTTAAGG - Intergenic
1029928180 7:104340962-104340984 GTAAGAATGACTAAATGTTCAGG - Intronic
1031308606 7:120164898-120164920 GAAAGCAGAACTAAAATATTTGG - Intergenic
1031718153 7:125134458-125134480 GAAAGCAGAACTTAAAGATTTGG + Intergenic
1032781928 7:135170652-135170674 GACGGCAGGGCTTAAAGTTCCGG - Exonic
1033304196 7:140212427-140212449 GCAACCTGGACTAGAAGTTCAGG - Intergenic
1033413735 7:141144640-141144662 GAGAGCAGGACTCTAAATTCAGG + Intronic
1035108614 7:156462288-156462310 GAGAGCAGGACTACAGTTTCAGG + Intergenic
1036988546 8:13565949-13565971 GAAATAAGTACTATAAGTTCAGG - Intergenic
1039390963 8:37180478-37180500 GAATCCAGGACTAAAACTACTGG - Intergenic
1039677531 8:39685682-39685704 GAAAGCAGAACTAAAAAATTTGG - Intronic
1039879342 8:41614581-41614603 GGAAGTAGGACTAAAAACTCAGG + Intronic
1041511964 8:58662492-58662514 GAAACCAAGAATAAAAGTTGTGG + Intergenic
1041985550 8:63918296-63918318 GAAAGCAGGACTGAGAGTGCTGG - Intergenic
1043134055 8:76499451-76499473 TAAAGCATGCCTAAAAGATCTGG - Intergenic
1044720388 8:95139946-95139968 GAAAGCAGGAGGAAAATTTAAGG - Intronic
1045351924 8:101349237-101349259 CAAAGCAGGAGTCACAGTTCAGG - Intergenic
1045741384 8:105364411-105364433 AAAATCAGGAAGAAAAGTTCAGG + Intronic
1047095997 8:121626512-121626534 GAAAGAAGGAAACAAAGTTCAGG - Intronic
1050069574 9:1796248-1796270 GAAAGCAGGAGTTAAAGGGCCGG - Intergenic
1050161226 9:2720317-2720339 GAAAGCAGGACTGGAAGTGAGGG - Intronic
1053357438 9:37458338-37458360 GAATGCAGGAGGAAAACTTCAGG - Intronic
1055384246 9:75743916-75743938 GAAAGCAGGAATAATACTCCTGG - Intergenic
1055424625 9:76181464-76181486 CAAAGCAGGACTCACAGTTGGGG - Exonic
1055501025 9:76902349-76902371 GAAAGCATGGCTAAAACTTAAGG + Intronic
1055502378 9:76914412-76914434 GAAAGAAAGACTCAAATTTCAGG + Intergenic
1055503193 9:76922252-76922274 CAAAGCAGGACTTAGAATTCTGG + Intergenic
1059785581 9:117579163-117579185 GAAAGGAGGACATAAATTTCAGG + Intergenic
1189118566 X:38369250-38369272 GAAAGCAGTATTAATTGTTCTGG - Intronic
1189674629 X:43448986-43449008 GAAAGCAGGGATAAAAATTAGGG + Intergenic
1193428380 X:81369149-81369171 TAAAGCAGGAATAAATGCTCAGG - Intergenic
1193558508 X:82986531-82986553 GAGAGGAGGACTAAAAGTATTGG + Intergenic
1195117877 X:101717953-101717975 CAAAGCAGGATTAAAAGGTTGGG + Intergenic
1195532069 X:105968853-105968875 GAAGGCAGGATTGAAAGTTCAGG + Intergenic
1198316494 X:135472079-135472101 GAAAGAAGTATTAAAAGTTTGGG + Intergenic
1199116712 X:144000763-144000785 GAAATCAGAACTCAAAGATCTGG - Intergenic
1199350002 X:146789195-146789217 GAAAGTAGGAATCAAAGATCAGG + Intergenic
1202201477 Y:22355459-22355481 GAAAACAGGACAAAATGTTTTGG - Intronic