ID: 956357203

View in Genome Browser
Species Human (GRCh38)
Location 3:68407069-68407091
Sequence ATCACGGAGAAACTGCATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956357203_956357208 12 Left 956357203 3:68407069-68407091 CCTAAATGCAGTTTCTCCGTGAT 0: 1
1: 0
2: 0
3: 13
4: 115
Right 956357208 3:68407104-68407126 AGAGTAGAAAGGTAAGAGTGAGG 0: 1
1: 0
2: 0
3: 39
4: 492
956357203_956357206 1 Left 956357203 3:68407069-68407091 CCTAAATGCAGTTTCTCCGTGAT 0: 1
1: 0
2: 0
3: 13
4: 115
Right 956357206 3:68407093-68407115 AGCCTGGAATGAGAGTAGAAAGG 0: 1
1: 0
2: 1
3: 18
4: 290
956357203_956357209 27 Left 956357203 3:68407069-68407091 CCTAAATGCAGTTTCTCCGTGAT 0: 1
1: 0
2: 0
3: 13
4: 115
Right 956357209 3:68407119-68407141 GAGTGAGGAGTAGTCCATACTGG 0: 1
1: 0
2: 0
3: 8
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956357203 Original CRISPR ATCACGGAGAAACTGCATTT AGG (reversed) Intronic
912630248 1:111240676-111240698 ATCACATAGAAAATCCATTTAGG - Intronic
916207449 1:162329073-162329095 ATCTGGAAGAAACTGGATTTTGG - Intronic
916223913 1:162471082-162471104 ATGAGTCAGAAACTGCATTTGGG - Intergenic
920979665 1:210821502-210821524 ATCACCTATAAACTGCAGTTTGG + Intronic
1063694594 10:8321187-8321209 ATCCCAGAGAAAATGCTTTTTGG + Intergenic
1066237654 10:33502052-33502074 AACACAGTGAAACTGCTTTTTGG + Intergenic
1066641129 10:37555382-37555404 TTCACCAAGAAACTGCATTTTGG + Intergenic
1068015979 10:51516587-51516609 ATCACAGTGACACTGCATTATGG + Intronic
1068494434 10:57768473-57768495 AGCAAGGAAAAACTGCAATTTGG + Intergenic
1074238210 10:111607714-111607736 ATCATTGAGAAAATGCATTTTGG + Intergenic
1076726275 10:132414971-132414993 ATTAAAGAGAAGCTGCATTTTGG - Intronic
1078102466 11:8337880-8337902 TTCCCTGAGAAGCTGCATTTGGG - Intergenic
1085954285 11:81372261-81372283 ATCAAGAAGCAACTGCATTATGG + Intergenic
1087129054 11:94653122-94653144 ATCACATAAAAACTGAATTTGGG - Intergenic
1090453340 11:126825938-126825960 ATCAAGGAGAATCTTCCTTTTGG + Intronic
1092522817 12:9291238-9291260 ATCAAGGATAAACAGCATCTCGG - Intergenic
1092544470 12:9440659-9440681 ATCAAGGATAAACAGCATCTCGG + Intergenic
1092955284 12:13543849-13543871 AGCAGGGAGATAGTGCATTTGGG - Exonic
1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG + Intronic
1094508479 12:31081408-31081430 ATCAAGGATAAACAGCATCTGGG - Intronic
1094604979 12:31942197-31942219 ATCAAAAAGAAACTGAATTTGGG + Intergenic
1094647216 12:32337443-32337465 ATCTTGGTGAAACTGAATTTGGG - Intronic
1095886387 12:47192879-47192901 ATCACAAAGAAAATGTATTTTGG + Intronic
1096700328 12:53379141-53379163 CTCACGGAGACTCTGCATATTGG + Intergenic
1096884791 12:54706353-54706375 ATCAGTGAGAAACTACATTCAGG - Intergenic
1097539864 12:60927429-60927451 AACATGAAGAAACTGCACTTGGG + Intergenic
1099420210 12:82448909-82448931 ATTATGGAGAAACTGAATTTTGG + Intronic
1100149264 12:91715664-91715686 CTCACAGAGAAGGTGCATTTTGG + Intergenic
1106830356 13:33574876-33574898 ATCACTGTGAAACTGATTTTAGG - Intergenic
1107576152 13:41724927-41724949 AGCACGGTGTGACTGCATTTAGG + Intronic
1108460940 13:50666764-50666786 ATCCTGGAGAAACTGCAGATGGG + Intronic
1108882687 13:55140398-55140420 ATTATGGAAAAACTACATTTGGG + Intergenic
1109941246 13:69368733-69368755 ATCAGGGAGAAATTGAATTCCGG + Intergenic
1111238412 13:85440389-85440411 AGCACTGAGAAACTGGCTTTAGG + Intergenic
1111248819 13:85576666-85576688 ATGAAAGAGAAACTGCCTTTGGG - Intergenic
1111620115 13:90714418-90714440 ATCAAGAAAAAAATGCATTTGGG + Intergenic
1112214210 13:97413316-97413338 ATAATGGAGAAGCTGCACTTTGG - Intergenic
1112368646 13:98775810-98775832 ATCACAAAAAAACTGGATTTGGG - Intergenic
1112448973 13:99492398-99492420 ATCAAAAAGAAACTGAATTTGGG + Intergenic
1118285953 14:64472967-64472989 TTCAAAGAGAAACTGAATTTTGG - Exonic
1118344007 14:64921406-64921428 ATGACGGAGAAAATATATTTGGG + Intronic
1125495075 15:40185711-40185733 ATAAAGAAGAAACTGCCTTTGGG - Intronic
1128010103 15:64285788-64285810 AGCACAGAAAAACTACATTTTGG + Intronic
1134542435 16:15078442-15078464 AAGACGCAGAAACTGCATTTCGG - Intronic
1135360016 16:21804525-21804547 AAGACGCAGAAACTGCATTTCGG - Intergenic
1135849028 16:25945754-25945776 AACATGGAGAAACTGAGTTTTGG - Intronic
1136262787 16:29092414-29092436 AAGACGCAGAAACTGCATTTCGG + Intergenic
1143992233 17:10975441-10975463 ATCCCCGGGAAAATGCATTTTGG - Intergenic
1144263003 17:13541542-13541564 ATCTCAGAGAAACTGGACTTAGG - Intronic
1144940204 17:18933480-18933502 CACACGGAGAAACTGTATCTGGG - Intergenic
1145291002 17:21545907-21545929 TTCAGGGAGAACCTGCATTTGGG - Intronic
1146999731 17:37352951-37352973 ATCACGGGGCAACTGATTTTTGG - Intronic
1147224406 17:38965341-38965363 AGAAAGGAGAAAATGCATTTTGG - Intronic
1151309146 17:73282826-73282848 ATCATGCAGAAACTGCCTTCAGG + Intergenic
1153034236 18:744352-744374 ATCAAGGAAAAAGTTCATTTAGG + Intronic
1155377217 18:25173296-25173318 ATCAGGAAGTGACTGCATTTTGG - Intronic
1160352349 18:78194375-78194397 ATCATGGAGAAAATTCATTCTGG + Intergenic
1163336012 19:16672099-16672121 AGCAGGGAGAAGCTGCATTTTGG + Intronic
1164487051 19:28667607-28667629 AGCAGGGACAAACTGCATTAGGG - Intergenic
1166913049 19:46174520-46174542 ATCATGGAAAAACTGGATGTTGG + Intergenic
1167069545 19:47212491-47212513 TTCACAGCTAAACTGCATTTTGG + Intergenic
925615619 2:5742183-5742205 ACCACAGATAAACTGCAATTGGG - Intergenic
931200399 2:60092243-60092265 ATCATGGAGAAACTTCTTTTTGG + Intergenic
935067497 2:99662704-99662726 ATGTAGGAGAAACTTCATTTTGG + Intronic
937145153 2:119638392-119638414 GTGATGGAGAAACTGCTTTTGGG - Exonic
940376958 2:152968209-152968231 ATCAAAAAGAAACTGAATTTGGG + Intergenic
940479590 2:154211724-154211746 ATCAAGGACAAACTGTATATAGG - Intronic
941394169 2:164954364-164954386 ATTAAGGTGAAACTGCATATGGG - Intronic
943016724 2:182520323-182520345 ATAAAGAAGAAATTGCATTTTGG - Intronic
1171398780 20:24858170-24858192 ATCATAGAGGAACTGCATGTGGG - Intergenic
1174304345 20:49604543-49604565 ATCTTGGAGGAACTGCATCTTGG - Intergenic
951518551 3:23589104-23589126 TTCACGGAGAAAATGCAGGTGGG - Intronic
952313586 3:32212431-32212453 ATAATGATGAAACTGCATTTTGG + Intergenic
952928840 3:38344050-38344072 ATCACAGATAAAATCCATTTAGG - Intergenic
953906294 3:46869950-46869972 ATCACGGAGAAACTGGAGACAGG + Intronic
956308450 3:67852336-67852358 ATCACAAAGAAACTGAATTCAGG + Intergenic
956357203 3:68407069-68407091 ATCACGGAGAAACTGCATTTAGG - Intronic
956529267 3:70199913-70199935 ACCAAGGCCAAACTGCATTTTGG + Intergenic
959486965 3:106937994-106938016 ATCACAGAAAAACTGCAGGTAGG + Intergenic
962462514 3:135627445-135627467 ATCACAGAATCACTGCATTTTGG - Intergenic
963087118 3:141447581-141447603 GTCACGCTGAAACTGCATTCCGG - Exonic
965317234 3:167207980-167208002 GGCACTGAGAATCTGCATTTGGG + Intergenic
968331328 3:197873027-197873049 ATGAGGGAGAAAATGCATTCAGG + Intronic
970622457 4:17837871-17837893 AATACTGAGGAACTGCATTTTGG + Intronic
971717355 4:30196140-30196162 ATCAAGGAGAAGATGGATTTTGG - Intergenic
973295630 4:48517433-48517455 ATCACGAAGAAAGTGCTTTTGGG + Intronic
975190746 4:71458863-71458885 TTCAAGGAGGAAATGCATTTTGG - Intronic
975443480 4:74437965-74437987 ATCAAAAAGAAACTGAATTTGGG + Intergenic
977993694 4:103476712-103476734 ATTTCAGAGAAAATGCATTTTGG + Intergenic
982378461 4:154721708-154721730 ATCACAGAGAAATAGAATTTTGG + Intronic
983700910 4:170592539-170592561 ATCACGGAGAAACTAGAACTGGG - Intergenic
987629152 5:20445158-20445180 ATAATGGAGAAAGTGAATTTTGG + Intronic
988282591 5:29169420-29169442 ATTATGCAGAAACTGCATCTTGG - Intergenic
993527822 5:88988388-88988410 ATCAAGGAGCAACTGTGTTTTGG + Intergenic
993752534 5:91688840-91688862 ATCACAGAAAATCTGCATTAGGG + Intergenic
994846790 5:104999638-104999660 TTCAAGGAGAGACTACATTTAGG - Intergenic
994977098 5:106822377-106822399 ATCATGGAGAACATGAATTTAGG - Intergenic
998031753 5:138876399-138876421 AACAGGGAGAAACTGGAGTTAGG - Intronic
998533722 5:142909661-142909683 ATAACAGAGAAATTACATTTAGG + Intronic
1005210327 6:23453249-23453271 ATCAATGAGAAACTTCCTTTTGG - Intergenic
1008029990 6:46684835-46684857 ATGACTGAAAAATTGCATTTAGG - Intergenic
1010659760 6:78556251-78556273 CTCACGGAGAACCTCCATTTGGG - Intergenic
1018366726 6:163128453-163128475 ATCATGTAGAAAATGAATTTAGG + Intronic
1018773214 6:166990437-166990459 ATCATGGAGAAAATGAAATTAGG + Intergenic
1019181948 6:170193016-170193038 GTCACGAAGAAACTGCTCTTTGG - Intergenic
1022248656 7:28585418-28585440 ATCACTGAGAAATTTCTTTTAGG + Intronic
1023367314 7:39476707-39476729 ATCCAGGAGAAACTGCTCTTAGG - Intronic
1034001007 7:147413255-147413277 TTCATGGAGAAACTAGATTTTGG + Intronic
1035909096 8:3546033-3546055 TTGATGGAGAAACTGCATTTTGG - Intronic
1036111593 8:5909065-5909087 ATAAAGGAGAAACTGAGTTTTGG + Intergenic
1036609673 8:10338992-10339014 ATCACTTAGAAAATGCAGTTTGG - Intronic
1039605067 8:38873821-38873843 TTCACCAAGAAGCTGCATTTTGG + Intergenic
1041468525 8:58182716-58182738 ATCAGGAAGGATCTGCATTTTGG + Intronic
1050336349 9:4593669-4593691 ATGACTGAGAAAATGCCTTTTGG - Intronic
1050356483 9:4788497-4788519 AACACGGTGAAACTCCATTTGGG - Intergenic
1050519052 9:6477715-6477737 ATCACACAGAAGCTGCATGTTGG - Exonic
1052229331 9:26129297-26129319 ATATCTAAGAAACTGCATTTAGG + Intergenic
1056982585 9:91328913-91328935 AACAGGGAGCAACTGCATATGGG - Intronic
1058508418 9:105689926-105689948 ATCACAGAGTAAATGAATTTTGG - Intergenic
1060899615 9:127245717-127245739 ATAAATGAGAAAATGCATTTAGG - Intronic
1188652582 X:32650201-32650223 ATCACTGATAAAATGGATTTTGG + Intronic
1189098173 X:38161546-38161568 ATCACAGAGAACTTGCCTTTAGG - Intronic
1190149678 X:47934307-47934329 GTCAAGGAGAATCTGTATTTTGG - Intronic
1192762380 X:74106638-74106660 ATCACATAGAAGCTGCATGTTGG - Intergenic
1193693666 X:84680362-84680384 ATCACAGAGAAACAGAATATTGG - Intergenic
1194307295 X:92263595-92263617 ATCTCAGAGAAACTGGGTTTTGG + Intronic
1197130289 X:122997777-122997799 CTCAGGGAGAAACTGTCTTTGGG - Intergenic
1197976792 X:132174190-132174212 ATCAAGGAGAAACTCCATAGAGG + Intergenic
1198570074 X:137945396-137945418 ATTAGGGAGAAATTGCATTAGGG + Intergenic