ID: 956358141

View in Genome Browser
Species Human (GRCh38)
Location 3:68416581-68416603
Sequence GATCTTAGCAGGTGAACTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956358141_956358145 30 Left 956358141 3:68416581-68416603 CCGGCAGTTCACCTGCTAAGATC 0: 1
1: 0
2: 1
3: 7
4: 83
Right 956358145 3:68416634-68416656 AATAAATTCTGATGAATGCATGG 0: 1
1: 0
2: 3
3: 36
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956358141 Original CRISPR GATCTTAGCAGGTGAACTGC CGG (reversed) Intronic
902575035 1:17372351-17372373 GATCTCAGCGGGTGAGATGCTGG + Exonic
904621260 1:31776718-31776740 GATCCTACAAGGAGAACTGCAGG - Intergenic
905778338 1:40685711-40685733 GAACTCAGCAGCTGGACTGCTGG + Intergenic
908968356 1:69794806-69794828 GCTCTTAGAAGGTGAACCACAGG + Intronic
915475034 1:156148212-156148234 GAAGGAAGCAGGTGAACTGCAGG - Intronic
920077543 1:203348150-203348172 GATCGTAGTAGGTGGACTGCTGG + Exonic
921093424 1:211864710-211864732 GATCTTAGCAGGAAAACTTTGGG + Intergenic
921119935 1:212127439-212127461 GAAGTTAGAAGGTGAACTGCAGG + Intergenic
921777570 1:219119621-219119643 GTGCATAGCAGGTGAACAGCTGG + Intergenic
1069523583 10:69146934-69146956 GATCTTAGCAGTAGAATTGCTGG + Intronic
1070604555 10:77889613-77889635 CAGCCTAGCAGGTGACCTGCTGG - Intronic
1074357592 10:112799702-112799724 GATCTGCGCAGGTGAACTCTGGG - Intronic
1075118483 10:119647061-119647083 GATCTGGGCAGATGAACTCCAGG + Intergenic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1084857360 11:71997720-71997742 GATGTCAGCAGGGGAACAGCTGG - Intergenic
1088886634 11:114012859-114012881 GATCTCAGGAGCCGAACTGCTGG - Intergenic
1090807976 11:130214645-130214667 GATCTTAACATGCTAACTGCAGG + Intergenic
1098141539 12:67454788-67454810 GATGTTAATAGGTGAACTGAGGG - Intergenic
1103046092 12:117735825-117735847 TATCTTAGAAGATGAAATGCAGG - Intronic
1104350007 12:128037020-128037042 TACCTGAGCAGGTGAACTGCAGG + Intergenic
1109407500 13:61920500-61920522 GTTCCTAGCAGCTGAAATGCAGG - Intergenic
1110203102 13:72876964-72876986 GATCTTAGTAGGACAACTTCAGG + Intronic
1117860193 14:60082283-60082305 TATCTTAGAAGTGGAACTGCTGG + Intergenic
1124412674 15:29449442-29449464 GAGCTTGGCAGGTGAAGTGCAGG + Intronic
1125887253 15:43238158-43238180 GATCTGAGCAGGTGCAAGGCAGG - Intronic
1130247104 15:82262312-82262334 TATCCAAGCAGGTGCACTGCCGG + Intronic
1136061248 16:27728164-27728186 CATCTTAGCAGGGCAACTGGTGG + Intronic
1136747548 16:32604950-32604972 GAACTTACCATGTGAACGGCTGG - Intergenic
1143767627 17:9148033-9148055 GATCTTTGCATGTGAAGTGGGGG + Intronic
1148341694 17:46877095-46877117 GTTCTTGGGAGGTGAACTGCTGG + Intronic
1154202666 18:12309707-12309729 GATCTTGGCGAGTGCACTGCAGG + Intronic
1155358819 18:24980144-24980166 AAGCCAAGCAGGTGAACTGCTGG - Intergenic
1157567302 18:48688270-48688292 AATCCTTGCAGGTGATCTGCTGG - Intronic
1157575208 18:48738963-48738985 GGTCTCAGGAGGGGAACTGCAGG - Intronic
1165915164 19:39254189-39254211 GCTCTCTGCAGGTGAACTGCAGG + Intergenic
925853279 2:8104827-8104849 GATCTTAGCAGGGCAACCGAGGG - Intergenic
928356429 2:30620506-30620528 TGTCTGAACAGGTGAACTGCAGG - Intronic
933432635 2:82203769-82203791 GATCTTACCATGTTGACTGCTGG - Intergenic
937530420 2:122820692-122820714 GATTAAAGCAGATGAACTGCAGG + Intergenic
937600324 2:123723890-123723912 GAGATTAGCATGTGAACTGGTGG - Intergenic
938704195 2:133906798-133906820 AGTCTGAGCAGGTGAACTGAAGG + Intergenic
941575983 2:167230847-167230869 TATCTTCGCTGGTAAACTGCTGG - Intronic
946445229 2:219733766-219733788 GAGCTTGGCAGGTGAGGTGCAGG + Intergenic
1171899683 20:30846162-30846184 GCTCTGAGCACGTGAACTTCAGG - Intergenic
1175157216 20:56979239-56979261 AATCTTTGAAGGTGAGCTGCAGG + Intergenic
1177406980 21:20682409-20682431 ATTATTAGCAGGTGAAATGCAGG + Intergenic
1178230318 21:30776230-30776252 GTTCCTGGCAGGTGAAGTGCAGG - Intergenic
1179615037 21:42578131-42578153 GATCTGAGCAGGTGTCCTGGGGG + Intronic
1183327081 22:37200093-37200115 GATCCTAGCAGGGGAAGAGCTGG - Intergenic
1183515783 22:38265220-38265242 GAGGTTGGCAGGTGAAGTGCAGG - Intronic
950002844 3:9670364-9670386 GTTCTTAGCAAGGAAACTGCTGG + Intronic
952001095 3:28786585-28786607 GAGCTTAGCATTTGAACTGATGG - Intergenic
953246868 3:41200492-41200514 TTTCTTACCAAGTGAACTGCAGG + Intronic
954069921 3:48135426-48135448 GATCTCAACTGGTGAGCTGCTGG - Intergenic
956358141 3:68416581-68416603 GATCTTAGCAGGTGAACTGCCGG - Intronic
959515248 3:107258883-107258905 AATCTCAGGATGTGAACTGCTGG - Intergenic
963476863 3:145817367-145817389 GCTCTTAGCAGTTGAACTTTTGG + Intergenic
965647902 3:170903184-170903206 GATTTTAGCAGAAGCACTGCAGG - Intronic
967794279 3:193581827-193581849 GATGTTAGCAGGAGAAATGTTGG - Intronic
968542431 4:1174812-1174834 CATCTCAGCAGATGAAGTGCTGG - Intronic
969971010 4:11048154-11048176 GATCCTGGCAGGTGAAGTGAAGG + Intergenic
974905757 4:68054616-68054638 GGTCTCAGCAGCTGAAATGCCGG + Intronic
977012288 4:91652881-91652903 GCTCTTTGCAGATGAATTGCTGG + Intergenic
977557858 4:98503083-98503105 GATCTCAGCAGGTGGACAGGTGG + Intronic
980491076 4:133530577-133530599 AATCTCACCAGGTAAACTGCTGG + Intergenic
985206817 4:187547310-187547332 GATCTTTGCAAAAGAACTGCCGG + Intergenic
995626198 5:114078862-114078884 GATATCAGCAGGTGCTCTGCAGG - Intergenic
996865696 5:128119097-128119119 AATCTTAGCAGTTGAGCTGTAGG - Intronic
996894991 5:128470284-128470306 GATCTTAGCAAGAGATCTTCTGG + Intronic
1003368501 6:5500564-5500586 CATCAGAGCAGGTAAACTGCAGG + Intronic
1004924917 6:20406829-20406851 CATCTTAGTTGGTGAACTGTTGG + Intronic
1004958320 6:20755919-20755941 ACTCTTAGCAGATGAACTTCTGG + Intronic
1009909305 6:69905476-69905498 CATCTTTGCAGATGAACAGCGGG - Intronic
1013779033 6:113710212-113710234 GATTTTAGCAGTTAAATTGCTGG - Intergenic
1013804556 6:113982835-113982857 GAGGTTAGAAGGTCAACTGCTGG - Intronic
1024012291 7:45279381-45279403 GATCTAAGCAAATGAACAGCAGG - Intergenic
1028239396 7:88400844-88400866 AATCTTAGCAGGTGAAAACCTGG + Intergenic
1033350732 7:140559700-140559722 GCTCGTACCTGGTGAACTGCTGG + Exonic
1034025115 7:147693922-147693944 GATCTTAGCAGGAGAACTTCAGG + Intronic
1034434175 7:151055265-151055287 CATCTTTGCAGGTGATGTGCTGG - Exonic
1037568446 8:20137683-20137705 GATCATAGCAGGTCATCTGTCGG - Intergenic
1038796573 8:30715608-30715630 GAACTTAAATGGTGAACTGCAGG - Intronic
1048506140 8:135023947-135023969 CATCTCAGCACTTGAACTGCTGG - Intergenic
1050135766 9:2462012-2462034 GATGTCAGCAGGTGGCCTGCTGG - Intergenic
1056824126 9:89865042-89865064 GATCTAAGGAGGAGAACTCCTGG + Intergenic
1057007223 9:91571094-91571116 AAGCTAAGCAGGAGAACTGCTGG - Intronic
1057806872 9:98225745-98225767 GATGTGAGCATGGGAACTGCTGG - Intronic
1060440838 9:123637771-123637793 TTTCTTAGCAGCTGAAATGCAGG + Intronic
1061881981 9:133573227-133573249 GATCTTGGCAGGAGGACAGCAGG + Intronic
1188097011 X:26035864-26035886 AATGTTAGCAGTTGAATTGCTGG + Intergenic
1192560268 X:72123716-72123738 GATGTCAGCAGGTGAACTCATGG - Intergenic
1198079119 X:133222148-133222170 GTTCATAGCAGGTGCTCTGCTGG + Intergenic