ID: 956362738

View in Genome Browser
Species Human (GRCh38)
Location 3:68466621-68466643
Sequence GATATAAGCAGTTCAACATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956362738_956362740 10 Left 956362738 3:68466621-68466643 CCTAATGTTGAACTGCTTATATC 0: 1
1: 0
2: 0
3: 10
4: 143
Right 956362740 3:68466654-68466676 ACACTGTTTTCAAGTCCTCTCGG 0: 1
1: 0
2: 3
3: 31
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956362738 Original CRISPR GATATAAGCAGTTCAACATT AGG (reversed) Intronic
904853972 1:33481403-33481425 TTTAGAAGCAGTTCAACTTTTGG - Intronic
905756750 1:40516795-40516817 AATATTAGCAGCACAACATTTGG + Intergenic
907495272 1:54839676-54839698 GCTATAATAAGTTCAACTTTAGG - Intronic
910214894 1:84833470-84833492 GATATAAGCCCTCCAGCATTGGG + Intronic
911264569 1:95727813-95727835 TATATAAGCACTTCAAAATGTGG - Intergenic
915787253 1:158627548-158627570 GATCTTAGCATTTCTACATTTGG + Intronic
920567234 1:206983915-206983937 GATGCCATCAGTTCAACATTTGG + Intergenic
922698694 1:227745348-227745370 CATATGAAAAGTTCAACATTAGG - Intronic
923586095 1:235272886-235272908 GACAGAAGCAGTTCAAGAATAGG + Intronic
923928330 1:238661887-238661909 AATATAACCAGTTCAACATAGGG - Intergenic
924120411 1:240791977-240791999 AATCTTAGCATTTCAACATTTGG - Intronic
1066251459 10:33637146-33637168 AATACAAGCAGTTGAACACTGGG + Intergenic
1068408262 10:56622134-56622156 GATAAGAGCAATTCAACTTTTGG - Intergenic
1068506698 10:57909181-57909203 GATATAAACATTTAATCATTTGG + Intergenic
1070426139 10:76289519-76289541 TTTATAAGGAGTTCAATATTAGG + Intronic
1071231198 10:83588231-83588253 GCTTTAAGAATTTCAACATTTGG - Intergenic
1074622757 10:115143238-115143260 GTTATAAATAGTTCAACATAAGG - Intronic
1075999065 10:126901280-126901302 GATGTAAGAAATACAACATTTGG - Intergenic
1079566296 11:21887458-21887480 GGTAGAAGCAGTTCAAGGTTGGG - Intergenic
1079885624 11:25984890-25984912 GATCTAACCAGTTCTACTTTGGG + Intergenic
1081311956 11:41585224-41585246 GAGATAAGCAGATCAACAAAAGG - Intergenic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1082753256 11:57045358-57045380 GAAAGAAGCAGTTCTAGATTGGG + Intergenic
1085606522 11:77904760-77904782 GATGTGAGGATTTCAACATTTGG - Intronic
1093097363 12:14986678-14986700 CAAATAAGCACTTCAACACTTGG + Intergenic
1094335404 12:29345096-29345118 GATATAAGCAGTTCTTGATCTGG - Intronic
1094974588 12:36307245-36307267 GATATTAGCTTTTCTACATTTGG - Intergenic
1097649462 12:62278973-62278995 GATATAGACAGTTCAACTTACGG - Intronic
1099916409 12:88900085-88900107 TATATAATCAGTTCAATAGTAGG + Intergenic
1103479026 12:121239015-121239037 CTTATAAGCAGTTCAGAATTAGG - Exonic
1107736225 13:43401171-43401193 GATATAAGAAGTTAAAGATCTGG - Intronic
1108712366 13:53046078-53046100 GATATATGCTGTTCAACATGTGG - Intronic
1109427302 13:62181906-62181928 GAGAAAAGCACCTCAACATTAGG + Intergenic
1109709005 13:66139546-66139568 GATATAAACACTTCAAGAATAGG + Intergenic
1110128351 13:71976670-71976692 TACATAACTAGTTCAACATTGGG + Intergenic
1110147011 13:72204092-72204114 GCTATAATCTTTTCAACATTAGG + Intergenic
1110580113 13:77111790-77111812 GATATGATCAGTTTTACATTTGG - Intronic
1112664228 13:101551301-101551323 AATATAATCAGTACTACATTAGG - Intronic
1113354519 13:109565865-109565887 AATATAAGAATTTCAACTTTGGG - Intergenic
1115474953 14:33804610-33804632 GATATAAGCAATGGAACAGTTGG - Intergenic
1115900967 14:38147905-38147927 GCTAAAAGCAGTTTATCATTTGG + Intergenic
1117704056 14:58444722-58444744 GATATAAGCACTTAAAAATATGG - Intronic
1118840648 14:69507909-69507931 GATCTCAGGAGTTCAACATAAGG - Intronic
1119614519 14:76090262-76090284 GAAATAAGCAGCTGAACTTTGGG - Intergenic
1126887107 15:53162960-53162982 GTTAGAAGCAGTTCCTCATTAGG - Intergenic
1127475796 15:59331656-59331678 GATATAAGTTGTTGAAAATTTGG - Intronic
1128952499 15:71901041-71901063 GTTATGAGCACTTCAAAATTGGG + Intronic
1130220042 15:82011720-82011742 GATATCAGAAGTTCAAAAATGGG - Intergenic
1132002960 15:98198284-98198306 GAAATAATCAGTTCCATATTTGG + Intergenic
1132564419 16:614707-614729 GAGTTAGGCAGTTCACCATTGGG - Intronic
1138326597 16:56176661-56176683 GATATAATAATTTCAGCATTTGG + Intergenic
1141866133 16:86751419-86751441 AATTTCAGCAGTTCCACATTAGG + Intergenic
1155436944 18:25823200-25823222 AAGAAAAGCAGTTCAACATTAGG + Intergenic
1157060685 18:44285556-44285578 GATTTATGCTGTTAAACATTAGG + Intergenic
1159487628 18:69085391-69085413 GAGTTAAGGAGTTCAACACTGGG + Intergenic
1160350957 18:78177878-78177900 GATATAAGCCCTTCAACTTGGGG + Intergenic
1166171763 19:41032813-41032835 CAAATAAGTAGTTCAACAATTGG - Intergenic
1166335442 19:42103595-42103617 TATATAAGCAATTCAACAGAAGG + Intronic
1167562623 19:50234912-50234934 GATACAAGAAGCTCAACAGTGGG - Intronic
925636470 2:5946159-5946181 AATATAAGCATTTCTGCATTGGG - Intergenic
926655611 2:15401716-15401738 CATAAAAGCAGTTAAAAATTAGG + Intronic
930917640 2:56713091-56713113 GGTATAAACATTTAAACATTTGG + Intergenic
931192526 2:60019093-60019115 GATATAATCATTTCAGAATTAGG + Intergenic
932427703 2:71651828-71651850 AATATAAAAAGTTCAACATTAGG + Intronic
936410982 2:112257948-112257970 GATATAAGAAGATCAATGTTGGG + Intergenic
936890957 2:117369598-117369620 GATAAAAACATTTCAGCATTAGG - Intergenic
937497619 2:122439803-122439825 TAAATAAGCAGTATAACATTTGG + Intergenic
939112710 2:138027693-138027715 GATATTAGCAGGGTAACATTAGG - Intergenic
940965173 2:159829141-159829163 GAAATAACCAGGACAACATTGGG - Intronic
943202625 2:184848290-184848312 GATATAAGAAGTACATAATTGGG - Intronic
945885270 2:215369383-215369405 GAATTAAGCAGTTGAGCATTTGG - Intronic
946539463 2:220667896-220667918 TATATAATCAGTTCAACTTAGGG - Intergenic
1170305711 20:14935522-14935544 GATATAACCACTTCAACACAAGG + Intronic
1173714211 20:45188077-45188099 TATAAGAGAAGTTCAACATTGGG - Intergenic
1173782322 20:45766381-45766403 GATTTAAACAGTTCATTATTTGG + Intronic
1183859834 22:40661856-40661878 GAGGAAAGCAGTCCAACATTAGG - Intergenic
1185205180 22:49533741-49533763 TATATAAACATTTCAACCTTTGG - Intronic
951646722 3:24899988-24900010 GATATAAGCATTTTTTCATTTGG + Intergenic
955041324 3:55320413-55320435 CCAATAAGCAGTTCAATATTTGG - Intergenic
955107721 3:55915067-55915089 GATATGAGCATTTCAACGATAGG - Intronic
955828527 3:62975760-62975782 GAAATAAGTAGTTGAGCATTTGG - Intergenic
956213945 3:66828754-66828776 GATATAAGCAATTTAAAATAAGG + Intergenic
956362738 3:68466621-68466643 GATATAAGCAGTTCAACATTAGG - Intronic
959811054 3:110619829-110619851 GATATAATCAGGTTAACATGAGG + Intergenic
962850514 3:139305302-139305324 GATCTAAGGAATTAAACATTAGG - Intronic
963884051 3:150560966-150560988 GATAAAAGCAGTTCCATTTTGGG - Intronic
965103651 3:164333746-164333768 GATACAAGCTGTTGAGCATTGGG - Intergenic
966006195 3:175015360-175015382 GATAAAAGTACTTGAACATTAGG + Intronic
967431755 3:189393399-189393421 GATAAAAGCTGTTTAACCTTTGG + Intergenic
967727757 3:192877902-192877924 GATACAAGTAGTTAAAGATTTGG + Intronic
970622052 4:17832514-17832536 GAAATAAGGAGTTCAATATTGGG + Intronic
971887419 4:32471050-32471072 GATTTAATCAGTTTAACATAAGG - Intergenic
971897590 4:32617536-32617558 TATATAATCAGTTGAACATCTGG - Intergenic
977630353 4:99235773-99235795 GAGATAGCCACTTCAACATTTGG + Intergenic
980188366 4:129491603-129491625 TATATAAAGAGTTCATCATTTGG + Intergenic
981555771 4:145991770-145991792 GAGATAACCAGTTAAGCATTTGG + Intergenic
983066479 4:163215884-163215906 GATAAAAGGAGTTCAAAAGTAGG + Intergenic
983429030 4:167623913-167623935 GATATAATTTGTTCAACAATGGG + Intergenic
985216214 4:187657247-187657269 GATATGGACATTTCAACATTAGG - Intergenic
989377617 5:40781113-40781135 GCTTTCAGCATTTCAACATTTGG + Intronic
989723356 5:44555690-44555712 ACTACAAGCAATTCAACATTAGG + Intergenic
990683698 5:58276146-58276168 AATATAAAAAGTTCAAAATTAGG + Intergenic
993594875 5:89841577-89841599 GATACCTGTAGTTCAACATTGGG - Intergenic
994321000 5:98394055-98394077 GATATAAGTACTTCATCTTTTGG + Intergenic
995422572 5:111983456-111983478 GATACAATTAGTTCAATATTGGG + Intronic
997040091 5:130242649-130242671 GCTTTAAGGATTTCAACATTTGG - Intergenic
999918732 5:156293558-156293580 GATATAATCATTTCAACAAATGG - Intronic
1003303592 6:4907013-4907035 GTAATAAGCAGTTCCACACTGGG + Intronic
1004150760 6:13118055-13118077 CAAATAAGAAATTCAACATTTGG + Intronic
1005521678 6:26606879-26606901 GACATGAGCAGTTTAGCATTTGG + Intergenic
1008817205 6:55582268-55582290 TATATAAAGTGTTCAACATTTGG + Intergenic
1010078940 6:71834844-71834866 GATATCAGCAATTTACCATTGGG - Intergenic
1011104409 6:83763326-83763348 AATACACGCAGTTCAAGATTTGG + Intergenic
1014500248 6:122179476-122179498 GATATACGAAGGACAACATTTGG + Intergenic
1014658936 6:124142238-124142260 GATATAAGAATTTCAGCAGTGGG - Intronic
1014834634 6:126147045-126147067 GATTTAAGCAGTTCAGCAAGTGG + Intergenic
1016064561 6:139666587-139666609 GATATCAGCAGCTCCCCATTTGG - Intergenic
1016224163 6:141713845-141713867 TATAAAAGCAATTGAACATTTGG - Intergenic
1020387042 7:7618141-7618163 GAGATAATTAGTTCAACTTTTGG - Intergenic
1021081784 7:16373314-16373336 GAAATAAGCAGTTTAAGATCTGG + Intronic
1021098174 7:16556758-16556780 GATACAAGGAGTTCAACCCTTGG + Intronic
1022421071 7:30223897-30223919 AATATCAGCATTTCAAGATTGGG + Intergenic
1023229583 7:38012406-38012428 GATATTAGCTGTCTAACATTGGG + Intronic
1023955435 7:44883591-44883613 GATAAAAGCAGTTTTACATTGGG - Exonic
1027997498 7:85443761-85443783 GATTTAAGTGGTTCAAGATTCGG - Intergenic
1033121659 7:138671823-138671845 ATAGTAAGCAGTTCAACATTAGG + Intronic
1037610292 8:20470306-20470328 GATATAATTAGGTCAACATGAGG - Intergenic
1041405508 8:57494756-57494778 GATAGAACCATTTCATCATTAGG - Intergenic
1041918324 8:63158036-63158058 GATACAAGCAGCTGAGCATTGGG - Intergenic
1042896305 8:73672273-73672295 GATATAAAAAGTTCAACAACAGG + Intronic
1043322889 8:79012027-79012049 GATATAAGCAGTTTAAACTGGGG + Intergenic
1044797601 8:95920192-95920214 TATATAAGCATTTCTTCATTGGG - Intergenic
1045201079 8:99982201-99982223 AATATATGCATTTCAACTTTAGG + Intronic
1045682582 8:104678744-104678766 GATATAAACTGGTCAACATTAGG + Intronic
1046214278 8:111122863-111122885 GAAAAAACCAGTTCAACATTTGG + Intergenic
1050855294 9:10346977-10346999 GATAAAAGTATTTAAACATTTGG - Intronic
1051291490 9:15550190-15550212 GATATAAAGAGTTGAATATTGGG + Intergenic
1055727390 9:79245642-79245664 GATATAAGGAGTTCAGCAAATGG - Intergenic
1055821665 9:80272153-80272175 GATATAAGCTGTTTAACACCAGG - Intergenic
1056410900 9:86325785-86325807 GTTATTAACAGTTCAAAATTAGG - Intronic
1056761051 9:89415258-89415280 GATGGCAGCAGGTCAACATTAGG - Intronic
1058180301 9:101790319-101790341 GATATAAGCAGATGCATATTTGG + Intergenic
1059016552 9:110522995-110523017 GATAAAAGCAGTATAACAATAGG - Intronic
1059081534 9:111255350-111255372 GTTTTAAGAAGTTCAACATTTGG + Intergenic
1187559328 X:20386260-20386282 CATATTAAAAGTTCAACATTTGG + Intergenic
1187990166 X:24861785-24861807 CATTTATGCAGTTCAAAATTTGG - Intronic
1193599502 X:83492568-83492590 GATAGAAGAAGTCCAAGATTTGG - Intergenic
1195868144 X:109455875-109455897 AATATCATGAGTTCAACATTGGG - Intronic
1196238352 X:113309191-113309213 GTTATAAGAAGTGCAACATTAGG - Intergenic
1197534860 X:127674985-127675007 GATGAAAGCATTCCAACATTTGG - Intergenic
1198731004 X:139728937-139728959 AACATAGGCAGTTCAAGATTCGG + Exonic
1198774848 X:140168776-140168798 GATATAAGGATATAAACATTTGG + Intergenic
1199471025 X:148196758-148196780 TATATAAACAGTGCAACTTTGGG + Intergenic
1200383695 X:155866987-155867009 GATAGAAGTAGTTCTATATTTGG - Intergenic