ID: 956364362

View in Genome Browser
Species Human (GRCh38)
Location 3:68483819-68483841
Sequence ACTTCGGGCTCCAGTGACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956364362_956364368 6 Left 956364362 3:68483819-68483841 CCAGTGTCACTGGAGCCCGAAGT 0: 1
1: 0
2: 0
3: 9
4: 92
Right 956364368 3:68483848-68483870 AAGGAAACAATAGGAGGTTGAGG 0: 1
1: 0
2: 1
3: 24
4: 385
956364362_956364366 -3 Left 956364362 3:68483819-68483841 CCAGTGTCACTGGAGCCCGAAGT 0: 1
1: 0
2: 0
3: 9
4: 92
Right 956364366 3:68483839-68483861 AGTTTATAGAAGGAAACAATAGG 0: 1
1: 0
2: 1
3: 42
4: 452
956364362_956364367 0 Left 956364362 3:68483819-68483841 CCAGTGTCACTGGAGCCCGAAGT 0: 1
1: 0
2: 0
3: 9
4: 92
Right 956364367 3:68483842-68483864 TTATAGAAGGAAACAATAGGAGG 0: 1
1: 0
2: 1
3: 40
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956364362 Original CRISPR ACTTCGGGCTCCAGTGACAC TGG (reversed) Intronic
900569896 1:3353050-3353072 ACTTCTGGCTCCAGAGCCCCAGG - Intronic
902334543 1:15747471-15747493 CCTTGGGCCTCCAGTGACCCGGG - Intronic
903895813 1:26603410-26603432 CCTTTGGGCTGAAGTGACACAGG - Intergenic
911284649 1:95974946-95974968 ACCTGGAACTCCAGTGACACAGG - Intergenic
912473652 1:109922772-109922794 ACTTCAAGCCCCAGAGACACTGG - Intronic
917932288 1:179831004-179831026 ACTTCGACCTCAAATGACACTGG - Intergenic
1064243177 10:13648673-13648695 AGCCCGGGCTCCAGTGACATCGG + Intronic
1065025264 10:21534663-21534685 ACCTCGTCCTCCAGTGACACGGG - Exonic
1067173926 10:43929335-43929357 GATTGTGGCTCCAGTGACACTGG - Intergenic
1067733943 10:48834604-48834626 CCTTCTGTCTCAAGTGACACTGG - Intronic
1069374107 10:67776531-67776553 TCTTCGGGCTGCAATGTCACAGG + Intergenic
1070850899 10:79560799-79560821 GCTGCAGGCTCCAGAGACACTGG - Intergenic
1070856300 10:79610475-79610497 GCTGCAGGCTCCAGGGACACAGG + Intergenic
1075639540 10:124055021-124055043 ACTTGGGGCTGCAATGACCCAGG + Intronic
1076898256 10:133324851-133324873 TCATCTGGCTCCAGGGACACGGG + Intronic
1081719866 11:45280702-45280724 TGTTAGGGCTCCACTGACACAGG - Intronic
1084145718 11:67264217-67264239 ACTAGGGGCACCAGTGACAGTGG + Intergenic
1084951833 11:72670734-72670756 ACTTCAGGGGACAGTGACACAGG + Intronic
1088753861 11:112868865-112868887 ACTTGGGGTTCCAGTGACCGTGG - Intergenic
1089083506 11:115797560-115797582 GCTTCAGGCTCCAATAACACTGG - Intergenic
1090699027 11:129278781-129278803 AGTGGGGGCTCCAGGGACACCGG - Intronic
1102219949 12:111187616-111187638 ACTCCAGGCACCAGTGGCACGGG - Intronic
1103416095 12:120742161-120742183 AGTTCGGGCTCCAGTGGCCCGGG - Intergenic
1106444561 13:29815169-29815191 TCTTTGTGCCCCAGTGACACAGG - Intronic
1122252577 14:100450232-100450254 ACATAGGGCTCCAGCCACACTGG + Intronic
1122927074 14:104909158-104909180 ACCTGTGGCCCCAGTGACACAGG + Intergenic
1127860381 15:62989074-62989096 GCTTCAGGCTCCAAGGACACTGG - Intergenic
1129104332 15:73295733-73295755 ACTCTGAGCTCCAGAGACACAGG - Intronic
1133604933 16:7377719-7377741 ATTTCAGGCACCAGAGACACAGG + Intronic
1143270686 17:5672535-5672557 AGTTCGAGCTCCAGTGCCTCTGG - Intergenic
1150252030 17:63711417-63711439 AGTTCAGGCTGCAGTGAGACGGG - Intronic
1157687996 18:49658453-49658475 TCATTGGGCTCCAGTCACACTGG + Intergenic
1160718387 19:586742-586764 AGTTCGGGGTCCAGTGACCCAGG + Intergenic
1161233374 19:3186489-3186511 ACTTAGGGCTCCAGGGACGCGGG - Intronic
1161590166 19:5125874-5125896 ACTTCGGGCTCCCGGGAAAACGG - Intronic
1164884872 19:31769978-31770000 AATTGGGCCTCCAGGGACACAGG - Intergenic
1167605656 19:50480297-50480319 TCTGCGGGCTCCAGAAACACAGG - Intronic
926103307 2:10134405-10134427 GCTAGGGGCCCCAGTGACACGGG + Intergenic
927199406 2:20569017-20569039 ACTTCGGGCACCAATGAGCCCGG + Intronic
928514692 2:32034675-32034697 AGTTTGTGTTCCAGTGACACAGG + Intronic
928743242 2:34380749-34380771 ACTGCAGCCTCCAGTGGCACTGG - Intergenic
934529943 2:95079008-95079030 ACTTCAGCCTCCAGTGTAACTGG - Intergenic
935787391 2:106561232-106561254 ACTTCGGAATCCAGTCACACAGG + Intergenic
937116226 2:119406898-119406920 GCCTCTGGCTGCAGTGACACTGG - Intergenic
1171459036 20:25288287-25288309 ACTTCAAGCCCCAGAGACACGGG - Intronic
1173662622 20:44745074-44745096 TCTCTGGGCTCCAGCGACACCGG + Intergenic
1175492741 20:59390106-59390128 CCTCCGGGCTCCAATGTCACAGG + Intergenic
1175988485 20:62776158-62776180 AGTGCGGGCTCCAGAGACAGAGG - Intergenic
1177546207 21:22561949-22561971 CCTTGGGGCTCCAGGGCCACTGG + Intergenic
1183743464 22:39680514-39680536 ACTGCGGGGCCCAGAGACACCGG - Intronic
953126751 3:40097737-40097759 ACTTCTGTCTACAGAGACACAGG - Intronic
956364362 3:68483819-68483841 ACTTCGGGCTCCAGTGACACTGG - Intronic
957955871 3:87186425-87186447 ACTAGAGGCTCCAGAGACACTGG - Intergenic
961065488 3:123871693-123871715 ACTTCAGGCTCAGGTGTCACTGG + Intronic
961611921 3:128146216-128146238 TCTTCTGGCTCCAGCCACACTGG - Intronic
964368125 3:155970952-155970974 ACCTCAGGCACCAGTGAGACTGG - Intergenic
964594686 3:158411630-158411652 ACCTCAGCCTCCAGAGACACTGG + Intronic
966620857 3:181962777-181962799 ACTTCTGTCCCCAGTGTCACTGG - Intergenic
969124524 4:4936556-4936578 ACACAGGGCTCCAGTGAAACAGG - Intergenic
969387189 4:6861247-6861269 TCTTCTGGCTCCAGTGAAGCAGG + Exonic
972821546 4:42707692-42707714 ATTTCTGGCACCAGTGAAACAGG - Intergenic
978646927 4:110945338-110945360 ACTTCGGGCTTCATTTCCACAGG - Intergenic
984081769 4:175255781-175255803 ACTTCAGCCTCCAGAGTCACTGG + Intergenic
991501296 5:67279834-67279856 ACTTGGGGCCACAGTGCCACGGG - Intergenic
992990104 5:82274996-82275018 ACTTTGTGCTCCAGCAACACTGG - Exonic
1002994792 6:2272629-2272651 CCTTCGGTCTCCACTGACACAGG - Intergenic
1006895130 6:37463290-37463312 ACTCCTGCCTCCAGGGACACAGG - Intronic
1006944876 6:37778508-37778530 ACTGTGGGGTCCAGTGTCACTGG + Intergenic
1011384356 6:86779039-86779061 TCACAGGGCTCCAGTGACACTGG + Intergenic
1013322687 6:109009829-109009851 TCTTCGGGCTTCAGGGACAGGGG + Intronic
1017282996 6:152643396-152643418 ACTTCTAGCTCCAGAGATACAGG + Intergenic
1022595713 7:31711888-31711910 GCTTTGGATTCCAGTGACACTGG + Intergenic
1024443623 7:49451520-49451542 TTTTCAGGCTTCAGTGACACTGG + Intergenic
1025936166 7:66039432-66039454 ACTTCAGACACCAGTCACACAGG + Intergenic
1034488512 7:151380941-151380963 ACTTCCTGCACCAGTGACACTGG + Intronic
1034586172 7:152094397-152094419 ACTTGGGCCTCGAGTGAAACGGG - Exonic
1036385444 8:8275465-8275487 AGTTCTTGCTCCAGTGACACTGG + Intergenic
1036463966 8:8979036-8979058 ACTTCTGGCTCCAGCGGCAGCGG + Intergenic
1037594902 8:20346870-20346892 CCTTGGGGCTCAACTGACACAGG - Intergenic
1038148555 8:24921020-24921042 ACCTCTGGCTGCAGTGGCACAGG + Intergenic
1038358568 8:26854682-26854704 TTTCCTGGCTCCAGTGACACTGG - Intronic
1038967675 8:32593527-32593549 ACTTCTGGTTCCAGTTACTCAGG + Intronic
1039612974 8:38933585-38933607 CCAACGGGCTCCAGGGACACAGG - Intronic
1041723360 8:60996299-60996321 AGCTCGTGCTCCAGTGACACAGG - Intergenic
1046444720 8:114302675-114302697 ACTTCTGAATCCAGTGACATTGG - Intergenic
1049332800 8:142064123-142064145 AGTTGGGGCTGCAGTAACACAGG + Intergenic
1051605615 9:18915281-18915303 ACTCTGGGCTCCAAGGACACAGG + Intergenic
1052835390 9:33246362-33246384 ACCGGGGGCTCCAGAGACACAGG + Intronic
1053276375 9:36786659-36786681 ACTTCCTGCTCCAGCCACACTGG - Intergenic
1054817088 9:69485881-69485903 ACTTCTGGCTCCATTGCCAATGG - Intronic
1055323916 9:75108784-75108806 ACTTCCGGCAGCAGTGACTCTGG + Intronic
1058976509 9:110129790-110129812 ACCTGGGGCTCCAGTCACATGGG - Intronic
1059705711 9:116821459-116821481 ACTTAGGGCTCCAGGGATAATGG - Intronic
1060129915 9:121086503-121086525 ATTGTGGGCTCCAGTCACACTGG - Intronic
1060667173 9:125438881-125438903 AATCCGGGCAGCAGTGACACTGG - Exonic
1060990650 9:127846820-127846842 ACTTGGGGTTCCAGTCACCCAGG - Intronic
1186726831 X:12366812-12366834 ACTTTCGGCTCAAGTGGCACTGG - Intronic
1186727045 X:12368252-12368274 GCTTTGGGCTGCAGTGTCACTGG - Intronic
1186961858 X:14745258-14745280 GGTTTGGGCTCCACTGACACAGG + Intergenic
1190263427 X:48813967-48813989 ATTTGGGCCTCCAGTGTCACAGG + Intronic
1192184127 X:68935036-68935058 TCTTTGGGCTCCAGGGACCCAGG - Intergenic
1192526129 X:71846205-71846227 AGTACTGGCTCCAGTGAGACTGG - Intergenic