ID: 956373325

View in Genome Browser
Species Human (GRCh38)
Location 3:68587507-68587529
Sequence TAACCTGAAGGACCGAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956373318_956373325 29 Left 956373318 3:68587455-68587477 CCAATGTCATTGCCTTTGCCATA No data
Right 956373325 3:68587507-68587529 TAACCTGAAGGACCGAAGGCTGG No data
956373321_956373325 11 Left 956373321 3:68587473-68587495 CCATAACTAAAAAAATATCTGGA No data
Right 956373325 3:68587507-68587529 TAACCTGAAGGACCGAAGGCTGG No data
956373317_956373325 30 Left 956373317 3:68587454-68587476 CCCAATGTCATTGCCTTTGCCAT No data
Right 956373325 3:68587507-68587529 TAACCTGAAGGACCGAAGGCTGG No data
956373319_956373325 17 Left 956373319 3:68587467-68587489 CCTTTGCCATAACTAAAAAAATA No data
Right 956373325 3:68587507-68587529 TAACCTGAAGGACCGAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956373325 Original CRISPR TAACCTGAAGGACCGAAGGC TGG Intergenic
No off target data available for this crispr