ID: 956376590

View in Genome Browser
Species Human (GRCh38)
Location 3:68619983-68620005
Sequence CTGCGTGCTGTACTTTGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956376590_956376593 28 Left 956376590 3:68619983-68620005 CCCCTTCAAAGTACAGCACGCAG No data
Right 956376593 3:68620034-68620056 CATATTATTCTTCATTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956376590 Original CRISPR CTGCGTGCTGTACTTTGAAG GGG (reversed) Intergenic
No off target data available for this crispr