ID: 956376592

View in Genome Browser
Species Human (GRCh38)
Location 3:68619985-68620007
Sequence TGCTGCGTGCTGTACTTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956376592_956376593 26 Left 956376592 3:68619985-68620007 CCTTCAAAGTACAGCACGCAGCA No data
Right 956376593 3:68620034-68620056 CATATTATTCTTCATTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956376592 Original CRISPR TGCTGCGTGCTGTACTTTGA AGG (reversed) Intergenic
No off target data available for this crispr