ID: 956376593

View in Genome Browser
Species Human (GRCh38)
Location 3:68620034-68620056
Sequence CATATTATTCTTCATTATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956376591_956376593 27 Left 956376591 3:68619984-68620006 CCCTTCAAAGTACAGCACGCAGC No data
Right 956376593 3:68620034-68620056 CATATTATTCTTCATTATTTTGG No data
956376592_956376593 26 Left 956376592 3:68619985-68620007 CCTTCAAAGTACAGCACGCAGCA No data
Right 956376593 3:68620034-68620056 CATATTATTCTTCATTATTTTGG No data
956376590_956376593 28 Left 956376590 3:68619983-68620005 CCCCTTCAAAGTACAGCACGCAG No data
Right 956376593 3:68620034-68620056 CATATTATTCTTCATTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956376593 Original CRISPR CATATTATTCTTCATTATTT TGG Intergenic
No off target data available for this crispr