ID: 956377522

View in Genome Browser
Species Human (GRCh38)
Location 3:68631571-68631593
Sequence ATGTTTTGCTAAGAGAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956377522_956377529 29 Left 956377522 3:68631571-68631593 CCCTCACTCTCTTAGCAAAACAT No data
Right 956377529 3:68631623-68631645 ATCTACCCTCACATAAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956377522 Original CRISPR ATGTTTTGCTAAGAGAGTGA GGG (reversed) Intergenic
No off target data available for this crispr