ID: 956384348

View in Genome Browser
Species Human (GRCh38)
Location 3:68701128-68701150
Sequence GTGGGTAAGACCCACAGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956384348_956384352 -5 Left 956384348 3:68701128-68701150 CCTTGGCTGTGGGTCTTACCCAC No data
Right 956384352 3:68701146-68701168 CCCACGATTCTGGGACAACAAGG No data
956384348_956384357 26 Left 956384348 3:68701128-68701150 CCTTGGCTGTGGGTCTTACCCAC No data
Right 956384357 3:68701177-68701199 CTGGCTACTGACCATCCTCCAGG No data
956384348_956384354 7 Left 956384348 3:68701128-68701150 CCTTGGCTGTGGGTCTTACCCAC No data
Right 956384354 3:68701158-68701180 GGACAACAAGGACAGCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956384348 Original CRISPR GTGGGTAAGACCCACAGCCA AGG (reversed) Intergenic
No off target data available for this crispr