ID: 956384351

View in Genome Browser
Species Human (GRCh38)
Location 3:68701146-68701168
Sequence CCTTGTTGTCCCAGAATCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956384351_956384357 8 Left 956384351 3:68701146-68701168 CCCACGATTCTGGGACAACAAGG No data
Right 956384357 3:68701177-68701199 CTGGCTACTGACCATCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956384351 Original CRISPR CCTTGTTGTCCCAGAATCGT GGG (reversed) Intergenic
No off target data available for this crispr