ID: 956386514

View in Genome Browser
Species Human (GRCh38)
Location 3:68725265-68725287
Sequence TCCAGCTGGCCAGCAGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956386514_956386518 3 Left 956386514 3:68725265-68725287 CCTGCCACTGCTGGCCAGCTGGA No data
Right 956386518 3:68725291-68725313 CCAAGCCAGTGAGTCTTATGAGG No data
956386514_956386522 15 Left 956386514 3:68725265-68725287 CCTGCCACTGCTGGCCAGCTGGA No data
Right 956386522 3:68725303-68725325 GTCTTATGAGGTGCCATGGGTGG No data
956386514_956386520 11 Left 956386514 3:68725265-68725287 CCTGCCACTGCTGGCCAGCTGGA No data
Right 956386520 3:68725299-68725321 GTGAGTCTTATGAGGTGCCATGG No data
956386514_956386524 17 Left 956386514 3:68725265-68725287 CCTGCCACTGCTGGCCAGCTGGA No data
Right 956386524 3:68725305-68725327 CTTATGAGGTGCCATGGGTGGGG No data
956386514_956386525 18 Left 956386514 3:68725265-68725287 CCTGCCACTGCTGGCCAGCTGGA No data
Right 956386525 3:68725306-68725328 TTATGAGGTGCCATGGGTGGGGG No data
956386514_956386523 16 Left 956386514 3:68725265-68725287 CCTGCCACTGCTGGCCAGCTGGA No data
Right 956386523 3:68725304-68725326 TCTTATGAGGTGCCATGGGTGGG No data
956386514_956386521 12 Left 956386514 3:68725265-68725287 CCTGCCACTGCTGGCCAGCTGGA No data
Right 956386521 3:68725300-68725322 TGAGTCTTATGAGGTGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956386514 Original CRISPR TCCAGCTGGCCAGCAGTGGC AGG (reversed) Intergenic
No off target data available for this crispr