ID: 956388345

View in Genome Browser
Species Human (GRCh38)
Location 3:68744983-68745005
Sequence GGGTAACACTTTGACGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 71}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956388345_956388349 1 Left 956388345 3:68744983-68745005 CCTTGTTCGTCAAAGTGTTACCC 0: 1
1: 0
2: 0
3: 7
4: 71
Right 956388349 3:68745007-68745029 TGATGGAGTTTCTTTGTGAAAGG 0: 1
1: 0
2: 0
3: 19
4: 251
956388345_956388350 9 Left 956388345 3:68744983-68745005 CCTTGTTCGTCAAAGTGTTACCC 0: 1
1: 0
2: 0
3: 7
4: 71
Right 956388350 3:68745015-68745037 TTTCTTTGTGAAAGGCTTTATGG 0: 1
1: 0
2: 2
3: 38
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956388345 Original CRISPR GGGTAACACTTTGACGAACA AGG (reversed) Intronic
908309638 1:62866513-62866535 GGTTAACACATTGACAAAAAGGG - Intergenic
908473446 1:64467542-64467564 GGATCACACTTTGAGAAACAAGG + Intergenic
912053851 1:105569838-105569860 TGGTAACACTGTGAAGAAAATGG + Intergenic
1063293711 10:4779505-4779527 GGGAAACATTTTGACAAGCAAGG - Intergenic
1063299834 10:4841578-4841600 TGCTAACACTTTGGTGAACAAGG - Intronic
1066477038 10:35757545-35757567 GGGTACCACTTGTATGAACAAGG - Intergenic
1069212089 10:65774451-65774473 GGGTAACACTGCAATGAACATGG + Intergenic
1069896833 10:71685273-71685295 GGACAACACTTTGAGGAGCAAGG + Intronic
1070951623 10:80435803-80435825 GGGTCACACTTTGAGAAGCATGG + Exonic
1075508934 10:123052975-123052997 GGGTAACATTTTCAGCAACATGG - Intronic
1082646207 11:55729779-55729801 GGGGAAAACTTTTACCAACAAGG - Intergenic
1082812937 11:57489558-57489580 GAGCAACACTTTGAGAAACATGG - Intronic
1086450273 11:86908804-86908826 GGGCCACACTCTGATGAACAAGG - Intronic
1095062862 12:37722384-37722406 TTGTAACACTTTGAGGCACATGG + Intergenic
1096299201 12:50411060-50411082 GGATAACACTTTGAACAGCAAGG - Intronic
1096757565 12:53812879-53812901 GGGGAACATTTTGAAGAACTGGG + Intergenic
1097307868 12:58089065-58089087 GGGTCACACTTTGAGTAGCAAGG + Intergenic
1103370871 12:120418316-120418338 GGGGCACACTTTGAGAAACATGG + Intergenic
1103752816 12:123177787-123177809 AGGTAACACTTTCACAAACAAGG + Intronic
1106681542 13:32013340-32013362 GGGTAACCCTGTGATGACCAAGG - Intergenic
1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG + Intronic
1108749242 13:53430439-53430461 GGGTCACACTTTGAGTAGCAAGG + Intergenic
1112109821 13:96283893-96283915 GGGTCACCCTTTGACTAGCAAGG + Intronic
1113739556 13:112701880-112701902 GGGTAACACTGGGAGGAAAAGGG - Intronic
1116054706 14:39848989-39849011 GGGCCACACTTGGACTAACAAGG - Intergenic
1121556631 14:94842804-94842826 GGATCACACTTTGAATAACAGGG + Intergenic
1130175403 15:81564012-81564034 GGATCACACTTTGAGAAACATGG + Intergenic
1137001896 16:35236062-35236084 GGGTATCACTTTGCCTACCATGG - Intergenic
1138302385 16:55943433-55943455 GGATAACACGTTGAAAAACAAGG - Intronic
1139380010 16:66524658-66524680 GGATCACACTTTGAGGAATACGG - Intronic
1142680409 17:1544542-1544564 GGGTTACAGTTTGAACAACAGGG - Intronic
1143333783 17:6157803-6157825 GGGTGAACCTTTGACCAACAGGG - Intergenic
1165066499 19:33232284-33232306 AGGTTACACTCTGACAAACATGG + Intergenic
926288209 2:11507616-11507638 GGGTATTATTTTGACTAACAAGG + Intergenic
926972659 2:18482386-18482408 TGGGAACACTTTGATGAGCAAGG - Intergenic
939040920 2:137188720-137188742 GGGTAACACATTGTCAAACCTGG - Intronic
942296803 2:174525349-174525371 GAGTATCACATTGACCAACAAGG + Intergenic
946960519 2:224980145-224980167 GGATGACACTTTGAGAAACATGG - Intronic
1174066471 20:47869242-47869264 GGGGAAGATTTTGACAAACAGGG - Intergenic
1175092265 20:56514018-56514040 GGGTCACACTTTGAATAACAAGG + Intronic
1178506750 21:33168974-33168996 GGGGAAAACTTTGACCAATAGGG - Intronic
952660990 3:35846478-35846500 GGGTCACATTTTGAGGAACTGGG + Intergenic
955148769 3:56346154-56346176 GTGTAACACTTTGAATAAAAAGG + Intronic
956388345 3:68744983-68745005 GGGTAACACTTTGACGAACAAGG - Intronic
958132600 3:89447941-89447963 CGGTCACATTTTGACGAACACGG + Intronic
967312467 3:188118875-188118897 GAGTAAGGCTTTGACGAACAGGG - Intergenic
972080195 4:35140396-35140418 GGGTAACAATGGGACAAACATGG + Intergenic
976130349 4:81877554-81877576 GGACCACACTTTGAAGAACAAGG + Intronic
976964812 4:91023826-91023848 GGGTCACACTCTGAGAAACATGG - Intronic
979600782 4:122584672-122584694 GGGAACCACTTTTACAAACACGG + Intergenic
988952565 5:36278321-36278343 GGATCACACTTTGAGGAGCAAGG - Intronic
994164212 5:96592044-96592066 GTCAAACACTTTGACAAACATGG - Intronic
996749541 5:126874940-126874962 GAGTCACACTTTGAGGAACCGGG + Intronic
997736309 5:136215116-136215138 GGGGAACACTTTGAGAAACACGG + Intronic
999786626 5:154896412-154896434 GGGAAATACTTTGAAGGACACGG - Intronic
1001865203 5:175097864-175097886 GGCCAACACTCTGAGGAACAAGG - Intergenic
1005953891 6:30650005-30650027 GGGTAATCCTTGGACGTACAGGG + Intronic
1007528221 6:42515579-42515601 GGGGAACTCTGAGACGAACATGG + Intergenic
1008334911 6:50291225-50291247 GGACCACACTTTGAGGAACAGGG - Intergenic
1012305983 6:97657993-97658015 TGCTAACACTTTGAAAAACAGGG - Intergenic
1015974698 6:138778006-138778028 GGGCAGCACTTTGAGTAACAAGG + Intronic
1025573871 7:62609446-62609468 TGGGAACACTTTGAGGAATATGG - Intergenic
1026641855 7:72133575-72133597 GGGTAAAAGTTTGACGATTATGG + Intronic
1028812640 7:95105369-95105391 GGGTAACAAGTTTACAAACACGG - Intronic
1029960198 7:104682294-104682316 GGATGACACCTTGAGGAACAAGG - Intronic
1043710137 8:83405063-83405085 AGGTAAAACTTTGACAAACAAGG + Intergenic
1050177207 9:2880691-2880713 GGGTCACACTTTGAGTAGCAAGG - Intergenic
1054859821 9:69938662-69938684 AGCTAACATTTTGAAGAACAAGG - Intergenic
1055825797 9:80322907-80322929 TGGTAACACTTTCATGAACCAGG - Intergenic
1056031510 9:82558536-82558558 GGATGACACTTTGAGGAACTTGG + Intergenic
1061221889 9:129256968-129256990 GGGAATCACTTTGAAAAACAGGG + Intergenic
1061346926 9:130033800-130033822 GGCTAACACAGTGACTAACATGG + Intronic
1188377329 X:29447913-29447935 TGGTAAGACTTTCATGAACATGG + Intronic
1188600181 X:31954148-31954170 GTGTAACTCTTTAACGAATATGG - Intronic
1189684815 X:43552927-43552949 GGGCAACACATTCACGGACAAGG + Intergenic
1190507082 X:51136960-51136982 TGGTAAAACTTTGACTAATATGG - Intergenic
1195227477 X:102813268-102813290 GGGTAATCCTTTGAGGAACATGG - Intergenic
1195410351 X:104563665-104563687 GGAAAACACTTTGAGAAACAAGG + Intergenic
1197219604 X:123898686-123898708 GGGTCACACTTTGTTGACCAGGG + Intronic