ID: 956388547

View in Genome Browser
Species Human (GRCh38)
Location 3:68747231-68747253
Sequence GAGAGAGAAAACTCACAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 1, 2: 4, 3: 40, 4: 350}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956388547_956388550 10 Left 956388547 3:68747231-68747253 CCCACTTGTGAGTTTTCTCTCTC 0: 1
1: 1
2: 4
3: 40
4: 350
Right 956388550 3:68747264-68747286 ACACACACACTGATACGGTTTGG 0: 1
1: 6
2: 34
3: 95
4: 523
956388547_956388549 5 Left 956388547 3:68747231-68747253 CCCACTTGTGAGTTTTCTCTCTC 0: 1
1: 1
2: 4
3: 40
4: 350
Right 956388549 3:68747259-68747281 CTCAAACACACACACTGATACGG 0: 2
1: 0
2: 5
3: 86
4: 817

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956388547 Original CRISPR GAGAGAGAAAACTCACAAGT GGG (reversed) Intronic
900130031 1:1083456-1083478 GAGAGAGAAGACGCAGAGGTGGG + Intronic
903899012 1:26629631-26629653 GGGAAAGAAAACTGAGAAGTTGG - Intergenic
904189263 1:28731032-28731054 GAGAGAGAAAACACATAGGAAGG - Intergenic
904196710 1:28791107-28791129 GAGAGAGAAAACTGATCAGCGGG + Intergenic
904424772 1:30416217-30416239 GAGACAGAAAACTCAAGTGTAGG - Intergenic
904480838 1:30792347-30792369 GAGAGAGAAAACTACCAAGACGG + Intergenic
904596333 1:31648333-31648355 GAGAGAGAACAGTGACAAGCTGG + Intergenic
905279244 1:36838379-36838401 GAAAGAGGAAACAGACAAGTAGG + Intronic
905344675 1:37303169-37303191 GAGAGAGAAAACTGATAACATGG + Intergenic
906291917 1:44625051-44625073 GAGAGAGAAAGCGCACAAACAGG + Intronic
906799308 1:48722061-48722083 GAGAGAGAAAATTGACAACTTGG + Intronic
907062605 1:51446101-51446123 GAGGCAGAAACGTCACAAGTGGG - Intronic
907426611 1:54383680-54383702 GAGAGAGAGAAATCAGAAGTGGG + Intronic
908085549 1:60628837-60628859 GAGACAGACAACTCAAAAATAGG - Intergenic
908779891 1:67680839-67680861 GAGAGAGAAAACTCACAAATTGG + Intergenic
909398907 1:75203235-75203257 AAGAGAGCAAACTCTCAACTGGG + Intronic
910043774 1:82887152-82887174 GAGAGAGAAGAGTAACATGTTGG + Intergenic
912268694 1:108187356-108187378 GAGAAAGAAAACACACCATTGGG + Intronic
912319597 1:108699671-108699693 GAGAAAGGAAACACAGAAGTAGG + Exonic
912484911 1:110018766-110018788 GAGAGAGATATTTCACAAATTGG + Intronic
914397181 1:147281107-147281129 GAGAGAGACAACTTAGAAGTGGG - Intronic
915121020 1:153629531-153629553 GAGAGAGAAGACTGCCAAGCCGG - Intronic
915947900 1:160167355-160167377 GAGAGAGAAAAACCCCAAGGTGG + Exonic
916349031 1:163827853-163827875 GAGAGAGAGAATTCACATCTGGG - Intergenic
916699654 1:167278348-167278370 GAGACTGAAAACTCCCAAGAGGG + Intronic
916779450 1:168008915-168008937 GAGAGAGAAAGCAAGCAAGTGGG - Intronic
918274090 1:182934688-182934710 GAGAGAAAAAAGTCATAAGTTGG - Intronic
918699556 1:187590789-187590811 GGGAGAGAAAATCAACAAGTGGG - Intergenic
919314966 1:195960645-195960667 GAGAGAGGAAACTGAGAAGATGG + Intergenic
919529243 1:198695791-198695813 GAAAAACAAAACTCACAACTAGG - Intronic
920064165 1:203254285-203254307 GAGTGAGAACACACACAAGATGG - Intronic
920771161 1:208887311-208887333 TAGAGAGAAAAATCAGAATTTGG + Intergenic
922280103 1:224114780-224114802 TGGGGAGAAAACTCAGAAGTAGG + Intronic
922445230 1:225691291-225691313 GAGACAGAATTCTCACAAGAGGG + Intergenic
923292248 1:232557513-232557535 GAGAGAGGAAACTCACTGGCTGG - Intronic
924493090 1:244559101-244559123 GAGAGTGAAAACTCACTTCTTGG + Intronic
1062992349 10:1832415-1832437 GAAAGAGAAAACAAGCAAGTGGG + Intergenic
1063740501 10:8813679-8813701 GAGAGAGATAACACCAAAGTGGG + Intergenic
1065422894 10:25566643-25566665 AAGAAAGAAAATTCACAACTGGG - Intronic
1065915654 10:30352634-30352656 GAGCGAGACATCTCACAAGGTGG - Intronic
1067279313 10:44859359-44859381 CAGAGAGAAAAGTCAAAACTTGG + Intergenic
1068020259 10:51573219-51573241 AAGGGAGAAAACTCAAAAGATGG - Intronic
1070517678 10:77223567-77223589 GTGACAGAAAACTCAGAAGCCGG + Intronic
1071555084 10:86595379-86595401 ATGAGACAAAATTCACAAGTTGG - Intergenic
1072679278 10:97494447-97494469 GAGAGAGAAAAATCCCAATCAGG + Intronic
1074463192 10:113657447-113657469 GTGAGAGAAAAGTGACAAGTGGG - Intronic
1075893639 10:125976409-125976431 GAGAGAGAAAGCAAACAACTTGG - Intronic
1077195110 11:1275809-1275831 GAAAGAGAATGCCCACAAGTGGG - Exonic
1077563568 11:3281719-3281741 GAGAGGGACAAAGCACAAGTAGG - Intergenic
1077569458 11:3327534-3327556 GAGAGGGACAAAGCACAAGTAGG - Intergenic
1078559042 11:12354835-12354857 GAGAGAGAAAATGCTCAAGGAGG + Exonic
1080572206 11:33566624-33566646 GAGAAAGAAAAGTCACAGCTAGG - Intronic
1080713247 11:34771029-34771051 GGGAGAGAAAACTAACAATTTGG - Intergenic
1080894018 11:36434093-36434115 CAGAGTGAAAACTCAGAAATGGG + Intronic
1081483138 11:43507264-43507286 GAGAGAGATAAAGCACAAGTAGG + Intergenic
1082664220 11:55953786-55953808 GAGAGAGAGAACTCACAAGATGG - Intergenic
1083358399 11:62085693-62085715 GAAAGAGAAAACAAACAAGCAGG + Intergenic
1083370802 11:62178531-62178553 GAGCTGAAAAACTCACAAGTTGG + Intergenic
1083424631 11:62576859-62576881 GAGAGAGGAAACTAACAAGATGG + Intronic
1085190322 11:74614877-74614899 GAGATAGAAAAATGACAAATTGG + Intronic
1086319639 11:85631080-85631102 GAGAGAGAAAAATCAGAAAGAGG - Intronic
1086328024 11:85724575-85724597 GAGAGAAGAAACTCACGAGAAGG - Intronic
1087581897 11:100066700-100066722 GGGAAAGAAAAATCACAGGTTGG - Intronic
1087953945 11:104260153-104260175 AAGATAGAAAAGTCACAAGGAGG + Intergenic
1089663396 11:120000724-120000746 GAGAGAGAAAACCCACCTGCAGG - Intergenic
1090622775 11:128576127-128576149 CAGAGAGGAAACTGACAAGAGGG + Intronic
1091274457 11:134341122-134341144 TAGAGAGAATAGCCACAAGTGGG - Intronic
1091308031 11:134552598-134552620 GAAAGAACAAACTGACAAGTTGG + Intergenic
1091325156 11:134681124-134681146 GAAAGAAAAAAATCATAAGTTGG - Intergenic
1091480474 12:824256-824278 GAGAAAGAAAAGTGACAATTAGG - Intronic
1091524036 12:1279051-1279073 GAGAGAGAAAACATACAATTAGG - Intronic
1091605564 12:1948736-1948758 CAGACAGAAAACTCACCATTGGG - Intronic
1091876196 12:3935308-3935330 AAGAGCGAAAATTGACAAGTGGG + Intergenic
1094698380 12:32843780-32843802 GACAGATAAAACTCAGAAGGTGG + Intronic
1095428139 12:42101219-42101241 GAAAGAGAAAACCAAGAAGTGGG + Intronic
1095470671 12:42533697-42533719 GAGAGAGAAAATACATAAATTGG + Intronic
1095533672 12:43221291-43221313 GGGAGAGAAAGCCCACCAGTGGG - Intergenic
1096202075 12:49691655-49691677 GAGAGAGAAAGGGCACCAGTGGG - Intronic
1096650244 12:53058974-53058996 GAGAGAGAAAATTCATGAGAGGG - Intronic
1096708869 12:53441117-53441139 GAGAGACAAAACTGATAATTTGG + Intergenic
1097325408 12:58270880-58270902 GAGAGAGAAATCTTAAAAATTGG - Intergenic
1097742152 12:63255803-63255825 GACTGAGAAAACTCACTTGTGGG + Intergenic
1100193550 12:92218827-92218849 GAGAGTGACAGCTCACAATTTGG - Intergenic
1100722145 12:97370514-97370536 AAGAGAGAAAACAGACAAGCTGG + Intergenic
1104267234 12:127244759-127244781 GAGAGAGGGAACTGAGAAGTTGG + Intergenic
1105499416 13:20958516-20958538 GAGACAGAAAATTGACTAGTTGG + Intergenic
1105500111 13:20964363-20964385 AAGAGAGAAAGTTAACAAGTTGG + Intergenic
1106464426 13:29999944-29999966 GGGAGAGAAAACACATAATTAGG + Intergenic
1106871184 13:34023199-34023221 GAGAAAGAAAACAAATAAGTAGG + Intergenic
1109883197 13:68508720-68508742 GAGAAATAAAACACACTAGTTGG + Intergenic
1111230434 13:85339056-85339078 TAAATTGAAAACTCACAAGTAGG - Intergenic
1111589929 13:90332549-90332571 AGGAGAGAAAAGTCACAAATAGG + Intergenic
1111667035 13:91282604-91282626 AAGAGAGAAAAGGCACAACTCGG - Intergenic
1113324987 13:109272200-109272222 GAGAGAGACATCTGAAAAGTGGG - Intergenic
1113468618 13:110529574-110529596 AAAAGAGAAAAATCACAAATTGG + Intronic
1113876882 13:113600244-113600266 GAGAGAGAACCCTCACACATAGG + Intronic
1113876898 13:113600336-113600358 GAGAGAGAACCCTCACACATAGG + Intronic
1113876946 13:113600601-113600623 GAGAGAGAATCCTCGCACGTGGG + Intronic
1113876994 13:113600902-113600924 GAGAGAGAATCCTCGCACGTGGG + Intronic
1114126591 14:19734087-19734109 GAGAGAGAAATTTCCCAAGAGGG + Intronic
1114218612 14:20676925-20676947 CAGTGAGAAAAATCACATGTTGG + Intergenic
1115041198 14:28930862-28930884 CAGAAAGAAAACTCATAATTAGG - Intergenic
1115930811 14:38491356-38491378 GAGAGAAAAAATTGATAAGTGGG - Intergenic
1116753015 14:48910484-48910506 AAGAGAGAAAAATTACAATTTGG - Intergenic
1117146253 14:52839375-52839397 GAGAGAAAATATTCACAAATTGG - Intergenic
1117240037 14:53821911-53821933 GAGAAAGAAAACTAAAAAGGTGG + Intergenic
1117931198 14:60842271-60842293 CAGAGAAAAAACTCTAAAGTGGG - Intronic
1118268575 14:64319405-64319427 GAAAAAAAAAACTGACAAGTTGG + Intronic
1119326347 14:73761774-73761796 GAGAGATAAAACTCACATGCAGG - Intronic
1119338955 14:73858704-73858726 GAGGGAGAAAAATCACATTTAGG - Intronic
1119979350 14:79061942-79061964 GACAGAGAAAACTCAGAAAGTGG - Intronic
1121695096 14:95905776-95905798 GAAACAGAAAAATCACCAGTAGG - Intergenic
1122538692 14:102484362-102484384 TAGACAGAAAACACACAACTTGG - Intronic
1122861718 14:104585461-104585483 GTGAGAGAAAATTCACACTTGGG + Intronic
1123570103 15:21596314-21596336 GAGAGAGAAATTTCCCAAGAGGG + Intergenic
1123606215 15:22031634-22031656 GAGAGAGAAATTTCCCAAGAGGG + Intergenic
1124075633 15:26441584-26441606 GAAAAAGAAAACACACAAATCGG - Intergenic
1125174081 15:36800239-36800261 GAGTGAGAATACTCATAACTAGG + Intronic
1125256807 15:37773736-37773758 GAAAGAGAAAAGTGAGAAGTTGG + Intergenic
1126322489 15:47440231-47440253 GAAAGAGAGAACTCAAAAGATGG + Intronic
1126662508 15:51046820-51046842 GAGAGAAAAAACTCTCCAGCAGG - Intergenic
1126935358 15:53701054-53701076 TACAGAGGAAACTCAAAAGTTGG + Intronic
1130363520 15:83211794-83211816 GAGAGAGACAACTCCCATGTTGG + Intergenic
1130453881 15:84084674-84084696 GAGAGAGAAAACACACTGGCAGG + Intergenic
1131419296 15:92290841-92290863 GAGAGAGAATTCTCTCCAGTTGG + Intergenic
1202978454 15_KI270727v1_random:323407-323429 GAGAGAGAAATTTCCCAAGAGGG + Intergenic
1132614113 16:831881-831903 GAGGGAAAAAACTCACAGGGCGG - Intergenic
1134137366 16:11686704-11686726 GAGAGAGTAAATAAACAAGTGGG - Intronic
1134396385 16:13868224-13868246 GAGAGAAATAACTGACAAGTAGG - Intergenic
1134657747 16:15959869-15959891 CAGAGAGAAAACTCACAGAGAGG - Intronic
1134657759 16:15959977-15959999 CAGAGAGAAAACTCACAGAGAGG - Intronic
1137230103 16:46556750-46556772 GAAAAAGAAAACACACAAATTGG + Intergenic
1137731632 16:50694245-50694267 GAAAGAGCAAACTCAGAAGCAGG - Intronic
1138829838 16:60361807-60361829 GGGAGAGAACACTCACAAGATGG + Intergenic
1138903659 16:61304165-61304187 GAGAGCTAAAATTCACATGTGGG - Intergenic
1140102307 16:71928268-71928290 GAGTGAGAAAACACACAAGGTGG - Exonic
1140376173 16:74447003-74447025 GAGGGAGAAGACTGACAAGGGGG + Intergenic
1141931016 16:87202957-87202979 GAGAGAGAGAACACACACCTGGG - Intronic
1142535195 17:610552-610574 GAGAGTGAAAACCCACAGATGGG + Intronic
1144531493 17:16043573-16043595 GAGAGAAAAAACTATAAAGTAGG + Intronic
1146814838 17:35934252-35934274 AAAAGAGAAAACTCAGAAGTAGG - Intergenic
1148689890 17:49521053-49521075 GAGAGAGAAAACCCAACAGAGGG + Intergenic
1149401492 17:56301010-56301032 TAGAGAGAAAACACAGAATTTGG + Intronic
1150847847 17:68677476-68677498 GAGAGTCAAAGCACACAAGTTGG + Intergenic
1150972822 17:70049112-70049134 GAGAGAAAAAACAGACAAATGGG - Intergenic
1152248435 17:79198606-79198628 GAGAGAGAAAGTTCAAAAGCAGG - Intronic
1155085808 18:22456789-22456811 GAGAGAGAAAAAACAGAAGGAGG + Intergenic
1155740583 18:29283465-29283487 GAGAGAAATAACTCCCAAGCTGG + Intergenic
1156006212 18:32445062-32445084 GAGAGAGAAAACAACCAACTGGG + Intronic
1156412149 18:36840749-36840771 CAGAGAAAAAAATCACAAGATGG - Intronic
1156846718 18:41674160-41674182 CAGAGAGAAATTTCACAAGCAGG - Intergenic
1158473161 18:57756689-57756711 GACAGAGAAAGCCCAAAAGTGGG - Intronic
1161670666 19:5606678-5606700 GAGAGAGAAAAGACACAAATTGG + Intronic
1163643598 19:18475798-18475820 GAGGGTCAAAACTCACAAGATGG + Intronic
1164444777 19:28307804-28307826 GAGAGAGGAATCCCACATGTAGG + Intergenic
1166231571 19:41427991-41428013 GAGAGAGAAGACGGGCAAGTGGG + Intronic
1166361981 19:42256292-42256314 GAGACAGAAAAGTCACAGATAGG + Intergenic
1167711479 19:51114139-51114161 GAGAAACAAAACTGGCAAGTTGG + Intergenic
1167765791 19:51481355-51481377 AAGAGAAAAAAATTACAAGTGGG - Intronic
1167812162 19:51842831-51842853 TAGAGAGAGAATTCCCAAGTTGG - Intergenic
1167981263 19:53277625-53277647 GAGTGAGAAAACTCTGTAGTGGG + Intergenic
1168008262 19:53508649-53508671 GAGAGAGAAATCTCATATTTTGG - Intergenic
1168203207 19:54832135-54832157 GAGAGAGCAAACTCCAGAGTTGG + Intronic
926388448 2:12362267-12362289 GGGATAGAAAACACTCAAGTAGG - Intergenic
927365165 2:22286551-22286573 GAAAGAGTGAACTCACTAGTTGG - Intergenic
927536085 2:23860105-23860127 GAGAGAGAGAATGCACAAGATGG - Intronic
927649660 2:24904634-24904656 GAGAGAAGAAACTTACAAGCTGG - Intronic
928764668 2:34629979-34630001 GAAAGGGAAACCTCACAAGTTGG + Intergenic
930916104 2:56690363-56690385 GGGAGAGAAACCACACAACTTGG + Intergenic
931751401 2:65333507-65333529 TAGAGAAAAAAATTACAAGTAGG + Intronic
932647501 2:73518934-73518956 GAAAGCAAAAACTGACAAGTGGG - Intronic
933863324 2:86492228-86492250 GACAGAGTACCCTCACAAGTTGG - Exonic
936408403 2:112229869-112229891 GAGACACAAAACACAAAAGTAGG + Intronic
936762914 2:115807696-115807718 GAGAGAAAAAAGGGACAAGTAGG + Intronic
937613955 2:123897420-123897442 GAGAGAGAATAAACAGAAGTTGG - Intergenic
937743861 2:125387526-125387548 GAGAGAGAAAAGAAAAAAGTGGG + Intergenic
938505433 2:131875797-131875819 GAGAGAGAGCACGCACAGGTAGG - Intergenic
938696337 2:133838484-133838506 GAAAGAGGGAACTCACATGTGGG + Intergenic
939109092 2:137985490-137985512 GAAAGAGAGAAGTCACAACTTGG - Intronic
939983361 2:148806721-148806743 GAAAGAAAAAACTCACTAGAGGG - Intergenic
940068217 2:149653706-149653728 GAGGGAGAAAATAGACAAGTAGG + Intergenic
940447706 2:153796277-153796299 AAGAGAGAAAACACAAGAGTGGG + Intergenic
940583263 2:155608678-155608700 GAGAGAGAAAACTAACTAGAGGG + Intergenic
941059495 2:160829317-160829339 TGAAGATAAAACTCACAAGTGGG + Intergenic
941633522 2:167910129-167910151 GAGAGTAAAAAATCACTAGTTGG - Intergenic
942452917 2:176119709-176119731 GATTAAGAAAACCCACAAGTTGG + Exonic
942524509 2:176839041-176839063 GAGAGAGAAAGGGCACAAATGGG + Intergenic
942787866 2:179720575-179720597 GAAAGAGAAAACACATAAGATGG + Intronic
942866956 2:180688010-180688032 AAAAGAGAAAAATCAGAAGTAGG + Intergenic
943916267 2:193636928-193636950 TAGAGAGGGAACTGACAAGTGGG + Intergenic
945417436 2:209591398-209591420 GAGATAGAAAACGAACAACTTGG - Intronic
1169557422 20:6766405-6766427 GAGAGAAAAAAGTCAGAAGCAGG - Intergenic
1169988383 20:11472311-11472333 GGGAGAGAAGACAAACAAGTAGG - Intergenic
1170123154 20:12933637-12933659 AAGAGAAAGAAATCACAAGTTGG + Intergenic
1170148198 20:13200478-13200500 GAGAGAGAAACTTCACTAGAAGG - Intergenic
1170422210 20:16204345-16204367 AAGAGAGAAAAGTCAAAAGCAGG + Intergenic
1171178954 20:23077453-23077475 GAGAGAGAGAACACAAAAGGGGG - Intergenic
1174274405 20:49393233-49393255 CAGAGAGAAAACTGGCAAGAGGG + Intronic
1174815992 20:53687570-53687592 GAAAAAGAAATCTCACAAATCGG - Intergenic
1174936871 20:54880373-54880395 GAGTGAGAAAAGCCACCAGTGGG - Intergenic
1175369205 20:58475868-58475890 GACAGAGGAAACACACAAGTAGG - Intronic
1177208218 21:18035255-18035277 AAGAAAGAAAACTCACAACCTGG - Intronic
1179231110 21:39504561-39504583 AAGAGAGAAACCTCAGAAGTGGG - Intronic
1180579930 22:16824545-16824567 GAGAGAGAAATTACAGAAGTAGG + Intergenic
1183083637 22:35473232-35473254 GAGAGAGAAAATGTAAAAGTGGG - Intergenic
1184965889 22:47972005-47972027 GAGAGAGAACCTTCACAAATGGG - Intergenic
950344760 3:12283040-12283062 TAGACATAAAAATCACAAGTGGG + Intergenic
950714248 3:14836546-14836568 GCCAGAGAAAACTCAAAAGTCGG - Intronic
952252993 3:31672398-31672420 GAGAGAGAGAACACACCAGGAGG + Intronic
952752261 3:36834387-36834409 AAAAGAGAAGAATCACAAGTTGG - Intronic
953368722 3:42369497-42369519 AAGAGAGGAAAATCACCAGTTGG + Intergenic
953879114 3:46682442-46682464 GACAGAAAAAACACAGAAGTGGG - Intronic
954482299 3:50811812-50811834 GAGAGAGAAATCACACTAATTGG + Intronic
954874254 3:53791065-53791087 GAAAGGGAAAAGTCTCAAGTGGG + Intronic
955059173 3:55481875-55481897 GAGAGTGAAAAATCAGAATTTGG - Intronic
955526407 3:59824796-59824818 GATAGAGAAAAGTTAGAAGTTGG - Intronic
956388547 3:68747231-68747253 GAGAGAGAAAACTCACAAGTGGG - Intronic
956913920 3:73850920-73850942 GAGAGAAAAAAATCAGAACTGGG + Intergenic
957274114 3:78068239-78068261 GAGAGAGGAGACCCACAAGTTGG + Intergenic
957838979 3:85641365-85641387 GTGAGAAAAATCTCACATGTTGG + Intronic
958009236 3:87854999-87855021 GAGACAGAGAACACACAACTAGG - Intergenic
958882030 3:99683018-99683040 CAGAGAGAAAAATCACCAGTAGG + Intronic
959956752 3:112248044-112248066 GAGAGAGCAAACCCTCAAGACGG - Intronic
960618792 3:119619895-119619917 GAGAGAGAAGACCCACTAGAGGG - Intronic
961835981 3:129660120-129660142 TAGAGAAAAAAGTCAGAAGTGGG - Intronic
963854471 3:150239347-150239369 GAGAGAGAAAATCCACATCTAGG + Intergenic
963930863 3:151002995-151003017 GAGACAGAAAATAAACAAGTAGG + Intergenic
964607817 3:158576627-158576649 GAGATAGAAAGCTCAGAAGCAGG + Intronic
965775272 3:172223177-172223199 GAGATAGTAAACTCACAGATTGG + Intronic
965899478 3:173620737-173620759 GAGATAGATAACACAGAAGTGGG + Intronic
966538171 3:181057744-181057766 GAGGGAGAAATCTCAAAAGATGG - Intergenic
967140856 3:186558642-186558664 GACATAGTAAATTCACAAGTTGG + Intronic
967141629 3:186566727-186566749 GGGAGAGTAAACTCAAAAGAAGG + Intronic
967253387 3:187565739-187565761 TAGACAGAAAACTGAAAAGTAGG - Intergenic
967472792 3:189882383-189882405 TAGAGAGAAAGGTCACAGGTAGG + Intronic
967584815 3:191199221-191199243 CAGAGAGAAAACTCACCACCAGG + Intronic
968011600 3:195283355-195283377 CAGATAGAAAGTTCACAAGTGGG + Intronic
970423383 4:15925599-15925621 GAGAGAGAAGCCACACTAGTGGG - Intergenic
970501624 4:16683062-16683084 GAGATAGAAAGCTCCCAAGTGGG - Intronic
971300048 4:25434348-25434370 GGGAGAGAAAACTCCCCAGGGGG + Intergenic
972086055 4:35217291-35217313 GAGAGAGAAAATTCAGTTGTGGG - Intergenic
972377850 4:38489587-38489609 GAGAGAGAGAACGCATAAGCAGG - Intergenic
973669723 4:53203886-53203908 GAGAGAGTAAAATCACATTTTGG + Intronic
973942720 4:55926575-55926597 GAGAGAGACAAGAAACAAGTGGG + Intergenic
974024309 4:56719597-56719619 TAAAGAAAAAACTTACAAGTTGG - Intergenic
974775494 4:66475530-66475552 GAGAGAGACAACTCAGAATGGGG + Intergenic
975494219 4:75020331-75020353 GAGAGAGAGAACTGAAAAGATGG - Intronic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
975926714 4:79464118-79464140 GAGAGAGAAAACAGAAAAGAGGG + Intergenic
976133319 4:81908011-81908033 AAGTGAGAAAACACAAAAGTTGG + Intronic
977652207 4:99483803-99483825 GGGAGAGAAAACAAGCAAGTTGG - Intergenic
978390251 4:108217661-108217683 GAAAGCAAAAACTGACAAGTGGG - Intergenic
979223553 4:118258746-118258768 GAGATAGAAAATTTTCAAGTAGG + Intergenic
979414048 4:120414935-120414957 GAGAGAGATAACAGAAAAGTTGG + Intergenic
979958981 4:126992794-126992816 GAGAGAGAAAACAAACTCGTTGG + Intergenic
981097937 4:140800730-140800752 GACAAAGAAAACACACAAGTTGG + Intergenic
982411268 4:155080232-155080254 GGGAGAGAAAAATCAAAAATTGG + Intergenic
982840332 4:160175977-160175999 GAGAGAGAAAACAAACAACTTGG + Intergenic
983163306 4:164444458-164444480 GAGAGAGAAAACACTTAAATTGG - Intergenic
984016821 4:174436603-174436625 GAGATAGTAAAGTCAGAAGTTGG - Intergenic
984444701 4:179821372-179821394 GAGAGAGAAAAGTAACCAGGGGG - Intergenic
984785575 4:183564598-183564620 AAGAAATAAAACTGACAAGTGGG - Intergenic
985045513 4:185936664-185936686 GAGACAGAATACTCAAAACTGGG - Intronic
985516713 5:349636-349658 AAGACAAAAAGCTCACAAGTTGG - Intronic
986486018 5:8238065-8238087 GAAAGAAAATAATCACAAGTGGG + Intergenic
988095790 5:26608189-26608211 GAGAGAGGATATGCACAAGTGGG - Intergenic
988645559 5:33091846-33091868 AAGAGAGAAAACAAACAATTTGG - Intergenic
989819140 5:45773229-45773251 GAGAGACAAAACAAACCAGTGGG + Intergenic
990508515 5:56468599-56468621 GAGAGAGAAAACATAGAAGTTGG - Intronic
991574520 5:68089072-68089094 ATGAGAGAAGACTCAGAAGTAGG + Intergenic
992105959 5:73448889-73448911 GGGAGAGAAAATTCACCCGTAGG + Intergenic
993668007 5:90724679-90724701 GAGTGTGAAAAGACACAAGTGGG - Intronic
994290229 5:98021187-98021209 GAGAGAGAAACTACAAAAGTTGG - Intergenic
994725921 5:103435121-103435143 GAGAAAAAAATCTCAGAAGTAGG - Intergenic
995392913 5:111659340-111659362 CAGAGAGAAAACTGACAAAATGG - Intergenic
995642163 5:114269101-114269123 GAGAGAGAACACTCCTAAGAAGG - Intergenic
995696455 5:114883577-114883599 GAGAGAGATCACACACAAGAGGG + Intergenic
996088610 5:119328651-119328673 GAGAGAAAAAAATAACAGGTTGG + Intronic
996969542 5:129347193-129347215 GAAAGATACAACTCACAAATTGG - Intergenic
998785645 5:145705843-145705865 GTGAGAAAAAAATCACAAGAAGG - Intronic
998968192 5:147563315-147563337 GGCAGAGAAAACTCAGAACTAGG - Intergenic
999104074 5:149053701-149053723 GAAAGTGAAAACTCACAAAGTGG - Intronic
999535874 5:152516601-152516623 GACAGTGGAAACTCAGAAGTGGG + Intergenic
999987598 5:157019154-157019176 GAAAGAAAAAAGTGACAAGTTGG + Intergenic
1000692036 5:164336119-164336141 GAGGGAGAAAAAATACAAGTAGG + Intergenic
1003006232 6:2384486-2384508 GAGAGAGAAACCTCAGAACGGGG - Intergenic
1003755566 6:9115858-9115880 GAGAGAGATAACTCACACGAGGG + Intergenic
1004130692 6:12916425-12916447 GAGAGAGAAAAATAACTAGCTGG - Intronic
1005404888 6:25475973-25475995 GAGACAGAAAACCCAGAAGGTGG - Intronic
1005594367 6:27365103-27365125 GAGGGAGAAAACTAATCAGTAGG - Intergenic
1005664782 6:28041475-28041497 GAGAAAGAAAACTCAGAATCAGG + Intergenic
1007883898 6:45203767-45203789 GAGAGAGAAAGTGCACAAATAGG - Intronic
1008229242 6:48963952-48963974 GAGGGAGAAAAAACACAAGTCGG + Intergenic
1008788025 6:55193930-55193952 AAGGGAGAAAAATCTCAAGTAGG + Intronic
1008839813 6:55888959-55888981 GAAAGAGAGAACACGCAAGTTGG - Intergenic
1008884319 6:56415632-56415654 GAGAGAGAAATCTTACAAAAGGG + Intergenic
1009049667 6:58261728-58261750 GATATAAAAAAGTCACAAGTGGG + Intergenic
1010573984 6:77510140-77510162 GAGAGAGTTAACTCACATGGGGG - Intergenic
1010870279 6:81028807-81028829 GAAATAGAAACTTCACAAGTAGG + Intergenic
1011337455 6:86276627-86276649 CAGAGAGAGAACACAGAAGTTGG - Intergenic
1011402261 6:86976236-86976258 GGGAGAGAAAAACCACAGGTGGG + Intronic
1012423908 6:99093924-99093946 GAGAAAGAAAAGGCGCAAGTAGG + Intergenic
1012896674 6:104957094-104957116 GAGAGAAAAAAATCAAAAGAAGG + Exonic
1013716089 6:112963691-112963713 GAGAGAGAGAATTAACAAATAGG + Intergenic
1014340175 6:120195314-120195336 CAGAGAGAAAACTCACTTCTCGG - Intergenic
1014583583 6:123168898-123168920 GAGAAAGAAAAAGCAAAAGTTGG + Intergenic
1017408543 6:154145801-154145823 GAGATAGAAAACCCAGAAATAGG + Intronic
1018419011 6:163626030-163626052 GAGGGAGAACACACACCAGTGGG + Intergenic
1018787007 6:167116329-167116351 GAGAGAGAGAATTCCCAAGAGGG - Intergenic
1020708533 7:11575930-11575952 CAGAAAGAAAATTCACCAGTGGG - Intronic
1021976750 7:26018578-26018600 GAGGAAGAAAAATCACATGTTGG - Intergenic
1022338709 7:29448150-29448172 GATACAGAAAACTCAGAACTTGG - Intronic
1022638122 7:32156356-32156378 GATAGAAAACACTCATAAGTGGG - Intronic
1023525911 7:41102771-41102793 GAGATTGAAAACTCAACAGTGGG + Intergenic
1023985698 7:45093768-45093790 GAAAGAAAAAATTCACAAGAGGG + Intergenic
1024051261 7:45624823-45624845 GAGAGAGAAAAGGCCCAGGTGGG - Intronic
1024051897 7:45629097-45629119 GAGAGAGTAAAATGAGAAGTGGG - Intronic
1024642901 7:51345824-51345846 GAGAGAAACAACCCACAAGTAGG + Intergenic
1024694950 7:51846319-51846341 GAGAGAGAAACTTCACAGGAAGG - Intergenic
1025716385 7:63961122-63961144 GACAGAAAAAACCGACAAGTAGG + Intergenic
1026597258 7:71743937-71743959 GGGAGAAAATATTCACAAGTAGG - Intergenic
1027168076 7:75850026-75850048 GACAGAGATAAATCAAAAGTTGG + Intronic
1027864457 7:83629009-83629031 TAGAAAGAAAACTCCCAAGCAGG - Intronic
1028890402 7:95981203-95981225 GAGGGAAAAAAATCACAAGAAGG + Intronic
1029218398 7:98969134-98969156 GACAGAGAAAACTTATCAGTAGG - Intronic
1030711568 7:112756327-112756349 AAGAGACTAAAGTCACAAGTTGG + Intergenic
1031488447 7:122358404-122358426 GAGAAAGAAAAGCCACAAATGGG - Intronic
1031717676 7:125128850-125128872 GAAAGATAAAACTCTCAAGTTGG - Intergenic
1031976040 7:128094223-128094245 CAGAGAAAAAACTCAGAAGTGGG - Intergenic
1032574542 7:133039194-133039216 GAGATAGAATACCCACAAATAGG - Intronic
1033519425 7:142145891-142145913 GAAAGAGAACACTGACATGTTGG + Intronic
1033896696 7:146080051-146080073 GAGAGAGAATACTGACAAGAGGG + Intergenic
1036968247 8:13325165-13325187 AAAAGAGAAATCTCAGAAGTTGG + Intronic
1037101968 8:15057871-15057893 GATTCACAAAACTCACAAGTGGG - Intronic
1037321252 8:17645530-17645552 CAGACTGAAAACTCACAAGAAGG + Exonic
1037354305 8:18000535-18000557 GAGAGAGAAAACTGGCTAGGAGG + Intronic
1041023732 8:53662794-53662816 AAGAAAGAAACCTCACAAATGGG - Intergenic
1041896398 8:62929345-62929367 GTGAGAAAAAAATCACAGGTTGG + Intronic
1044001300 8:86884308-86884330 GACAGAGACAATTCCCAAGTGGG - Intronic
1044420936 8:91995149-91995171 GAGAGAGAAAACTAGTAAGTTGG - Intronic
1046310232 8:112426514-112426536 GTGGGAGAAAAATCACAATTAGG - Intronic
1046460520 8:114528182-114528204 CAAAGAGAAAACTCACCAGCAGG + Intergenic
1046497633 8:115035636-115035658 GAGAAAGAAAATCCAAAAGTGGG + Intergenic
1046615158 8:116469170-116469192 GATGGAGAAAAATCACATGTTGG + Intergenic
1049045021 8:140142906-140142928 GAGGAAGAAAACTCACAAGTTGG - Intronic
1050119878 9:2297384-2297406 GAGAAAGAAAACTCACATTAGGG - Intergenic
1050399676 9:5239153-5239175 GGGAGAGGAAACTAACAACTGGG - Intergenic
1050747607 9:8894897-8894919 GAGAGAGACAACACACAATTTGG + Intronic
1052254744 9:26441960-26441982 GTGAGAGTAAACTCACAAGTTGG - Intergenic
1052683471 9:31724474-31724496 GAGAGACACAACTCACACGACGG + Intergenic
1053045025 9:34908422-34908444 GAGAGAGAAAGCAAACAAATAGG + Intergenic
1053566903 9:39262381-39262403 GAGGTGGAAAACTCATAAGTGGG + Intronic
1054130240 9:61356626-61356648 GAGGTGGAAAACTCATAAGTGGG - Intergenic
1054597873 9:67087186-67087208 GAGGTGGAAAACTCATAAGTGGG - Intergenic
1054860988 9:69953176-69953198 GAGGGATAATACTCCCAAGTGGG - Intergenic
1056086464 9:83154490-83154512 CAGTGAGAAAACTCACAGCTGGG + Intergenic
1056225294 9:84489293-84489315 GAGATAGATAACACACAAGGAGG + Intergenic
1056428331 9:86501334-86501356 AGGGGACAAAACTCACAAGTGGG + Intergenic
1057357588 9:94344659-94344681 CAGAGAGAAAATAAACAAGTAGG - Intergenic
1057650165 9:96912966-96912988 CAGAGAGAAAATAAACAAGTAGG + Intronic
1057887523 9:98841534-98841556 GAAAGAGAAAAATCACCATTTGG - Intronic
1059607204 9:115846409-115846431 GAGAGAGAAAAGTCACAATTGGG - Intergenic
1059886151 9:118746949-118746971 GAGAGAAAACACCCTCAAGTTGG - Intergenic
1060232329 9:121834873-121834895 GAGAGAGCAGACTTCCAAGTGGG - Intronic
1061269527 9:129530120-129530142 GAGATAGAAAACTAAGAAGTCGG + Intergenic
1062504263 9:136865440-136865462 CAGAGAGAAAACTCTCAGGGAGG + Intronic
1185561405 X:1063067-1063089 GACAAAGAAAAATCATAAGTGGG + Intergenic
1185743123 X:2549921-2549943 GAGAGAGACATCTGAAAAGTAGG + Intergenic
1186227660 X:7418797-7418819 GACAGAGAAAATTCTAAAGTAGG - Intergenic
1186747963 X:12589382-12589404 GAGAGAAACTGCTCACAAGTGGG + Intronic
1186785637 X:12954132-12954154 AAGACAGAGAACACACAAGTGGG + Intergenic
1187617119 X:21008349-21008371 TAAAGAGAAAACTCATAGGTTGG + Intergenic
1189549966 X:42082817-42082839 CAGAGAGAAAAGTCATATGTTGG + Intergenic
1189615345 X:42777938-42777960 GAGAAAGAAATCCCAAAAGTGGG - Intergenic
1189999972 X:46676414-46676436 GTGGGAAAAAACTCACAAATTGG - Intronic
1190643047 X:52498785-52498807 GAGACAGAGAACTCAGAATTTGG - Intronic
1190644626 X:52514082-52514104 GAGACAGAGAACTCAGAATTTGG + Intronic
1191667458 X:63718077-63718099 GAGAAACAATACTCAGAAGTGGG - Intronic
1191816892 X:65255107-65255129 GAGAGAGAAATCACACAACTTGG + Intergenic
1192320868 X:70089509-70089531 GAGAGAGAGAACCAAGAAGTGGG - Intergenic
1192982872 X:76365871-76365893 GAGAGAGAAATCAAGCAAGTTGG - Intergenic
1194350867 X:92824263-92824285 GAGAGAGAAAATTCTAAAGAGGG + Intergenic
1195551794 X:106180021-106180043 AAGAGAAAAAACTTAGAAGTCGG - Intronic
1195583021 X:106530261-106530283 GAGAGAGTACACTCACCAGCTGG + Intergenic
1196110720 X:111944330-111944352 GAGAGAGAGAACGAACAAGTGGG + Intronic
1196309191 X:114141811-114141833 GAGGGAGAGAACTCATAACTAGG - Intergenic
1196770085 X:119284726-119284748 GAGAGGGAAAGCTGAAAAGTAGG - Intergenic
1197027590 X:121773523-121773545 GAGACTGAAGACTCAGAAGTGGG - Intergenic
1197923091 X:131616741-131616763 GAGAGAGAAAACAAAGAAGGAGG - Intergenic
1198226768 X:134652539-134652561 GGGAGAGAAAATTCAGAAGTGGG + Intronic
1198506344 X:137304732-137304754 GAGAGGAAGAACTCACAGGTGGG - Intergenic
1199592158 X:149477452-149477474 GAGAGAACAAACCGACAAGTTGG - Intergenic
1199923200 X:152431710-152431732 GAGGGAGAAGAGTCAGAAGTGGG + Intronic
1200416219 Y:2913501-2913523 GAGACTGAAAACAAACAAGTGGG + Intronic
1200659192 Y:5940946-5940968 GAGAGAGAAAATTCTAAAGAGGG + Intergenic
1201571076 Y:15414894-15414916 GAGAGAAAAGACCCACAGGTAGG + Intergenic