ID: 956390830

View in Genome Browser
Species Human (GRCh38)
Location 3:68771106-68771128
Sequence ATGGGGAGTCAGAAGGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1613
Summary {0: 4, 1: 34, 2: 93, 3: 278, 4: 1204}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956390830 Original CRISPR ATGGGGAGTCAGAAGGGGGA TGG (reversed) Intronic
900561336 1:3308510-3308532 TCGGGGAGTCAGCTGGGGGAGGG + Intronic
900745400 1:4357266-4357288 TAGGGGAGCCAGAAGGGAGATGG - Intergenic
900792212 1:4688080-4688102 GTGGGGAGCCAGGATGGGGAAGG + Intronic
900938407 1:5781553-5781575 TTGGGGGGTGAGATGGGGGATGG - Intergenic
900940904 1:5798096-5798118 ATGGGGAGAGAGGAGGTGGAGGG + Intergenic
900965205 1:5952677-5952699 GTGTGGAGTCAGAAGCGTGATGG - Intronic
901154256 1:7124903-7124925 AGTGGGAGTCAGGAAGGGGAAGG + Intronic
901156984 1:7146678-7146700 GTGGGCAGTCAGAGGGGGTAGGG + Intronic
901266443 1:7914239-7914261 ACGGGGAGGGGGAAGGGGGAGGG - Intergenic
901429441 1:9203943-9203965 ATGGGGTGTCATAGTGGGGAAGG + Intergenic
902006481 1:13236370-13236392 AAGGGGAGTTAGAAAGGGGATGG + Intergenic
902025534 1:13380755-13380777 AAGGGGAGTTAGAAAGGGGATGG + Intergenic
902112504 1:14094152-14094174 ATGAGGAGTGAGAAACGGGAGGG + Intergenic
902598492 1:17525176-17525198 ATGGGGAGGGAGGAGAGGGAGGG + Intergenic
903472019 1:23593818-23593840 ATGGGCATTTTGAAGGGGGAAGG + Intronic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
904347053 1:29879392-29879414 ATGAGGAGTGAGTGGGGGGAGGG - Intergenic
904447747 1:30588552-30588574 ATGAGGAGTGAGTTGGGGGAGGG + Intergenic
904526306 1:31136395-31136417 ATGGGGAGCAGGAAAGGGGATGG - Intergenic
904577993 1:31517809-31517831 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
904852346 1:33468483-33468505 CTGAGGAGTCAGAAGGGTAAAGG + Intergenic
904883780 1:33720444-33720466 AAGGGGATTCAGAAGGATGAAGG + Intronic
905310688 1:37046903-37046925 GTGGGGGGTCAGAAGGAGGAGGG + Intergenic
905649782 1:39648433-39648455 AAGGAGAGTGAGAAGGGAGATGG + Intergenic
905792012 1:40794849-40794871 CTGTGGAGCCAGAAGAGGGAGGG + Intronic
905794355 1:40807274-40807296 CTGGAGAGTCACAAGGCGGAAGG + Intronic
905830193 1:41059500-41059522 ATGGGGAGCTGGAAAGGGGATGG - Intronic
906280407 1:44549598-44549620 ATGGGGAAGCAGAACTGGGAGGG - Intronic
906301432 1:44684900-44684922 GTTGGGAGTCAGGTGGGGGAAGG - Intronic
906601839 1:47137367-47137389 GTGGGGAGAGTGAAGGGGGAGGG - Intergenic
906693821 1:47810904-47810926 ATGGGCAGGCAGAAGGGAAAGGG - Intronic
906727746 1:48056045-48056067 AGGTGGAGGCAGAAGAGGGAGGG - Intergenic
906736161 1:48130938-48130960 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
906751580 1:48267498-48267520 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
906953205 1:50350783-50350805 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
907236799 1:53056824-53056846 TTGGGGAGGCAGAAGGTGGGAGG - Intergenic
907394291 1:54178531-54178553 ATGTGGAGTCAGAGGGAGGAGGG + Intronic
907462145 1:54611499-54611521 AAGGGATATCAGAAGGGGGAAGG - Intronic
907814340 1:57903503-57903525 TTGGGGAGAAAGAAGGTGGAAGG - Intronic
908182391 1:61618883-61618905 ATGGGCAGGCAGAAGGGGGAGGG + Intergenic
908780967 1:67689347-67689369 CAGGGGAGCCATAAGGGGGACGG - Intergenic
908836059 1:68231175-68231197 ATGGGGAGACAGTGAGGGGAAGG + Intronic
908892116 1:68860041-68860063 ATGCGGAACCAGAAGGGCGATGG + Intergenic
908896777 1:68909963-68909985 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
909742288 1:79045379-79045401 TAGGGGAGCCAGAAGGGAGATGG + Intergenic
909770917 1:79420138-79420160 GTGGGGTGCCGGAAGGGGGAAGG + Intergenic
909862997 1:80632646-80632668 ATGGGGAGCCAGAGGGGAGATGG - Intergenic
909986953 1:82172906-82172928 AAGGGGAGTTGGAAGGGGGATGG - Intergenic
910050945 1:82973446-82973468 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
910363744 1:86441574-86441596 GTGGGGAGTGGGAAGGGAGAAGG + Intronic
910442343 1:87265710-87265732 ATGGGGACTGAGAAGGTGGAAGG + Intergenic
910477201 1:87620062-87620084 TGGGGGAGACAGAAGGGAGATGG - Intergenic
910630009 1:89344631-89344653 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
910840680 1:91558426-91558448 TTGGGGAGGGGGAAGGGGGATGG - Intergenic
911061080 1:93748327-93748349 ATGGAGAGTAAAAAGGGAGATGG - Intronic
911310701 1:96289065-96289087 AATGGCAGTCAGAAGGGGGATGG + Intergenic
911335439 1:96575177-96575199 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
911430028 1:97773781-97773803 ATGGGGAGCTAGAAGGGGGATGG - Intronic
911587220 1:99704878-99704900 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
911764448 1:101657004-101657026 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
911795329 1:102068738-102068760 TTAGAGATTCAGAAGGGGGAGGG + Intergenic
911946207 1:104112760-104112782 TTGGAGACTCAAAAGGGGGAAGG - Intergenic
912003539 1:104864322-104864344 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
912041469 1:105396691-105396713 ATGGGGAATTGGAAAGGGGATGG + Intergenic
912509673 1:110180413-110180435 ATGGGGTGTAAGATGGGGAAAGG - Intronic
912631001 1:111246768-111246790 ATGGGTAGTAAGACTGGGGAAGG + Intergenic
912875565 1:113355199-113355221 CTTGGGAGGCAGAAGTGGGAGGG - Intergenic
913199427 1:116484058-116484080 ATGTGGGGGCAGGAGGGGGAGGG + Intergenic
913322918 1:117601949-117601971 GTAGGGATCCAGAAGGGGGATGG - Intergenic
913457604 1:119049290-119049312 TGGGGGAGCCAGAAGGGAGATGG - Intronic
914214604 1:145613892-145613914 ATGGGGAGGCTGAAGTGGAAGGG - Intronic
914466546 1:147934282-147934304 ATGGGGAGGCTGAAGTGGAAGGG - Intronic
914542820 1:148632287-148632309 TTTGGGAGGCAGAAGTGGGAGGG + Intronic
914818852 1:151084152-151084174 TTAGGGAGGCAGAAGTGGGAGGG - Intronic
914902258 1:151717002-151717024 CTGGGGAGTAAGATGGGGGAAGG - Intronic
915162397 1:153929736-153929758 ATGGAGAGTGAGAAAGGGAAGGG - Exonic
915293433 1:154902068-154902090 TGGGGGAGTCAGTATGGGGATGG + Intergenic
915564558 1:156706389-156706411 AGGGGGTCTCAGTAGGGGGAAGG + Intergenic
915835697 1:159173087-159173109 GTGGGGAGAGTGAAGGGGGAGGG + Intronic
915953432 1:160205263-160205285 ATGGAGAGGCAGGAGGGGGCGGG - Intergenic
916284718 1:163093733-163093755 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
916336255 1:163673991-163674013 ATCAGGAGTTAGAAGGAGGAGGG + Intergenic
916598874 1:166273102-166273124 ATGGTGACTCAGAGTGGGGAAGG + Intergenic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
916841950 1:168609862-168609884 CTGAGGAGACAGAGGGGGGAGGG + Intergenic
916902779 1:169247640-169247662 TTGGCGACTCAGAAGAGGGAGGG - Intronic
916951576 1:169785489-169785511 ATGGGGAGCTGGAAGGGGGATGG + Intronic
917099532 1:171431447-171431469 ATGGGCAGCTAGAAAGGGGATGG + Intergenic
917193544 1:172443845-172443867 ATGGGGTGCCAGAAGAGTGAAGG - Exonic
917254863 1:173103599-173103621 TGGGGAAGTCAGAAGGGGGATGG + Intergenic
917410822 1:174758452-174758474 TTGGAGACTCAGAAGGGGAAAGG - Intronic
917589195 1:176459637-176459659 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
918188141 1:182145593-182145615 GTGGGGAGACAGAAAGAGGAAGG + Intergenic
918362363 1:183772072-183772094 TGGGGGAGCCAGAAGGGAGATGG - Intronic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
918809284 1:189094445-189094467 CTGGGGAGCCAGAAGGGAGATGG - Intergenic
918813359 1:189149952-189149974 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
918928876 1:190826700-190826722 ATGGAGATTCAGAAGGGTGAGGG + Intergenic
919048162 1:192480347-192480369 ATGGGGAGCTAGAAGGGGGATGG - Intergenic
919110888 1:193217436-193217458 TAGGGGAGCCAGAAAGGGGATGG + Intronic
919199891 1:194342756-194342778 ATCGGGAGACAGAAGGGGGATGG - Intergenic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
919982040 1:202647820-202647842 AGGGGGAGGGAGGAGGGGGAAGG - Intronic
920019675 1:202945849-202945871 ATGGAGACTTAGAAGCGGGAGGG + Intronic
920050582 1:203162354-203162376 CTGGGTGGTCAGAAGGGTGAGGG + Intronic
920255611 1:204652219-204652241 AAGGGGAGAGAGGAGGGGGAAGG - Intronic
920461105 1:206141140-206141162 ATGCGGAGTTAGAAGGGGGATGG - Intergenic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
920756452 1:208738385-208738407 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
921092199 1:211854982-211855004 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
921095620 1:211884945-211884967 ATGAGCATTCAGAAGGTGGAGGG - Intergenic
921221714 1:212978371-212978393 ATGGGGAGAAAGACTGGGGAAGG + Intronic
921362348 1:214341572-214341594 ATGGCCAGGCAGAAGGGGAATGG - Intergenic
921403533 1:214753476-214753498 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
921422066 1:214959677-214959699 AAGTGGAGGCAGAAGGGAGAGGG + Intergenic
921447889 1:215268124-215268146 ATGGGGAGTTAGAATAAGGATGG - Intergenic
921456807 1:215380803-215380825 AAGGGGAGGAAGAAGTGGGAAGG + Intergenic
921819117 1:219596443-219596465 AAGAGGAGTGAGAAGGGGAAAGG + Intergenic
921891011 1:220353491-220353513 ATGGGGAGCCACAAGCGGTATGG - Intergenic
922223761 1:223627926-223627948 GTGGGGAGGCAGACGTGGGAGGG + Intronic
922334298 1:224606376-224606398 ATGGGGAGCTGGAAAGGGGATGG + Intronic
922647199 1:227300658-227300680 GTGGAGACTCAGAAGGGAGAAGG + Intronic
922724755 1:227917658-227917680 ATGTGGGCTCAGAAGGGTGATGG + Intergenic
923252676 1:232191852-232191874 AGGGGAAGCCAGAAGGGGGATGG - Intergenic
923383787 1:233447029-233447051 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
923482471 1:234397500-234397522 AGGGGGAGGGGGAAGGGGGATGG + Intronic
923601693 1:235409241-235409263 ATTGGTAGGCAGAAGGAGGAAGG + Intronic
923853228 1:237819574-237819596 TTTGGGAGGCTGAAGGGGGATGG + Intronic
923975481 1:239257319-239257341 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
924108113 1:240669712-240669734 ATGGAGACTCAGAAGGGTGAAGG - Intergenic
924501506 1:244642824-244642846 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
924606324 1:245538614-245538636 ATGGAGAGACAGACAGGGGAAGG - Intronic
924718740 1:246603766-246603788 CTAGGGAGGCAGTAGGGGGATGG + Intronic
1062833577 10:622257-622279 AGGGGGAGGGAGGAGGGGGAGGG + Intronic
1062833584 10:622270-622292 AGGGGGAGGGAGGAGGGGGAGGG + Intronic
1063233245 10:4086728-4086750 CGGGGGAGGCAGAAGAGGGACGG - Intergenic
1063523401 10:6761120-6761142 ATGGGGAGTTGGAAGGGGGATGG - Intergenic
1063527086 10:6796416-6796438 ATGGGGAGTCAGGAGGCAAATGG - Intergenic
1063906430 10:10784493-10784515 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1064682459 10:17824830-17824852 ATGGGGAAACAGAAAGGGTAGGG - Intronic
1064795817 10:19010040-19010062 ATGGGGAGCCAGAAGAGGTATGG + Intergenic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1065009138 10:21405964-21405986 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
1065454402 10:25891951-25891973 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1065778297 10:29142975-29142997 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1066047198 10:31604044-31604066 ATGGGGAGGCAACAGGAGGAGGG - Intergenic
1066182346 10:32975474-32975496 ATAGGAACTCAGAAGGGGCAAGG - Intronic
1066243644 10:33561504-33561526 GTGGGCACTCAGATGGGGGAAGG + Intergenic
1066251471 10:33637281-33637303 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
1066355603 10:34680583-34680605 AAGGGGAATGAGAAGCGGGAGGG + Intronic
1066356338 10:34687800-34687822 ATGTGGAGTCAGTAGGTGGCGGG - Intronic
1066444499 10:35469654-35469676 ATGGAGAGTCAGACGGGAGATGG + Intronic
1067174478 10:43933941-43933963 ATGGGGAATTGGAAAGGGGATGG - Intergenic
1067369651 10:45671681-45671703 GTGGGGAGTGAGATGGGGGGAGG + Intronic
1067570757 10:47369253-47369275 ATGGAGAGTCTGCAGGGGAAGGG + Intronic
1067897627 10:50201161-50201183 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1067935266 10:50605904-50605926 ATGGAGACTCAGAAGGGTGAAGG - Intronic
1068258330 10:54543143-54543165 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1068497902 10:57808387-57808409 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1068553280 10:58429594-58429616 ATGGAGACTCAGAAGAGTGAAGG - Intergenic
1068640260 10:59396956-59396978 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
1068947251 10:62741909-62741931 ATATGGAGGCAGAAGAGGGAGGG - Intergenic
1069067554 10:63959509-63959531 ATACAGATTCAGAAGGGGGAGGG + Intergenic
1069807928 10:71137604-71137626 ATGAGGGGACAGGAGGGGGAAGG - Intergenic
1070328807 10:75403982-75404004 GAGGGGAGTCAGGTGGGGGAGGG - Intergenic
1070363845 10:75716997-75717019 ATGGGGAGAGAGAAAGGGGATGG - Intronic
1070669265 10:78366662-78366684 ATGGGGAGAGGGAAGGGGGTAGG + Intergenic
1070780976 10:79137479-79137501 AGGGGGAGTGGGAAGGGAGAGGG - Intronic
1071028133 10:81139979-81140001 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1071038763 10:81280949-81280971 CAGGGGAGACAGTAGGGGGATGG + Intergenic
1071220421 10:83459018-83459040 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1071299595 10:84246386-84246408 CTGGAGACTCAGAAGGGGAAGGG - Intronic
1071916985 10:90303976-90303998 ATTGGGAGTCAGAGGAGTGAGGG - Intergenic
1072108022 10:92291830-92291852 TTGGGGAGGGGGAAGGGGGAGGG - Intronic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072380165 10:94859564-94859586 GTGAGGAGTTAGAAGGGAGATGG + Intergenic
1072444979 10:95491252-95491274 TTGGGAAGTCAGAGTGGGGAAGG - Intronic
1072696961 10:97611100-97611122 CTGGGAAGTCAGGAAGGGGAAGG - Intronic
1072897177 10:99376991-99377013 GTGGGGAGGAAGAAGGGGGAGGG - Intronic
1073358297 10:102874781-102874803 AAGGGGTGGCAAAAGGGGGAAGG + Intronic
1073428435 10:103470658-103470680 ATGGGGAGTTAGCAGGGAGAAGG - Intergenic
1074734847 10:116419596-116419618 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
1075093709 10:119457608-119457630 CTGGGGACTCAGTAGGGAGAAGG - Intronic
1075222890 10:120600267-120600289 CTGGAAAGTCACAAGGGGGATGG + Intergenic
1075284483 10:121171785-121171807 AAGGGAAGGCAGAAGGGGAAGGG + Intergenic
1075570045 10:123534958-123534980 TAGGGAAGTCACAAGGGGGAGGG + Intergenic
1075585434 10:123653789-123653811 AGGGGAAGGGAGAAGGGGGAAGG + Intergenic
1075688622 10:124380481-124380503 TTGGGGAGTCAGGAGGAGCATGG - Intergenic
1075992113 10:126846798-126846820 GTGGGGAGTCAGGACGGGGATGG - Intergenic
1076838411 10:133032723-133032745 ATGAGGAGGGAGAAGGGGGCAGG - Intergenic
1076856020 10:133115987-133116009 ATGGGGAGGGAAAAGAGGGAGGG - Intronic
1076893849 10:133299112-133299134 ATGGGGAGTCAGGATTGGGTAGG + Intronic
1077368474 11:2170789-2170811 ATGGGGAGCCTGGTGGGGGAGGG + Intronic
1077586705 11:3459388-3459410 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1077712978 11:4554366-4554388 GTGGGGAGCCGGAAAGGGGATGG - Intergenic
1078113927 11:8426178-8426200 ATGGGGAGCCAGAAGGGAGATGG + Intronic
1078523080 11:12078897-12078919 TTGGGGAGTGGGATGGGGGAGGG - Intergenic
1078703685 11:13717144-13717166 ATGGGGAGGCGCGAGGGGGAAGG - Intronic
1078736354 11:14024425-14024447 ATGGGGGGCCAGAAGAGGGATGG + Intronic
1079312550 11:19379220-19379242 ATGGGGCGTGAGCAGGGGCAAGG + Intronic
1079929260 11:26537579-26537601 ATGGGGAGACAGAAGGCCCATGG - Intronic
1080015662 11:27504195-27504217 ATGGGAAATCAGAATGGTGAAGG - Intronic
1080112327 11:28582044-28582066 ATGCGGAGTGAAGAGGGGGAGGG - Intergenic
1080675792 11:34425551-34425573 TTTGAGACTCAGAAGGGGGAGGG + Intergenic
1081053726 11:38381363-38381385 ATGGGGAGTGTGAAGGGGATTGG - Intergenic
1081155908 11:39690144-39690166 TTGGAGACTCAGAAAGGGGAAGG - Intergenic
1081312586 11:41592129-41592151 ATGAGGAGCTGGAAGGGGGATGG + Intergenic
1081329993 11:41790749-41790771 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1081352092 11:42066401-42066423 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1081654494 11:44848581-44848603 ATTGGGAGTGAGGAGGGGGCGGG + Intronic
1081730758 11:45370193-45370215 AGGGGCAGTCAGGAGGAGGAGGG + Intergenic
1082119269 11:48360618-48360640 TTGGAGACTCAGAAGCGGGAAGG + Intergenic
1082132370 11:48506231-48506253 AGGGGGAGAGGGAAGGGGGAAGG - Intergenic
1082255027 11:50024529-50024551 CTGGAGACTCAGAAGCGGGAAGG - Intergenic
1082292250 11:50389865-50389887 GTGGGGTGTGGGAAGGGGGAGGG + Intergenic
1082565833 11:54676851-54676873 AGGGGGAGAGGGAAGGGGGAAGG - Intergenic
1082710365 11:56547301-56547323 ATGGGGAGCCAGAAAGGGGACGG - Intergenic
1082749764 11:57003130-57003152 ATGGGGAGCCGGAAAGGCGATGG + Intergenic
1082751418 11:57022501-57022523 ATGGGGAGCTGAAAGGGGGATGG + Intergenic
1083107647 11:60373932-60373954 ACAGGGAGCCAGAACGGGGATGG - Intronic
1083132662 11:60640300-60640322 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1083490133 11:63009707-63009729 TTAGGGGATCAGAAGGGGGAGGG + Intronic
1083970879 11:66074165-66074187 CTGGGAAGTGAGAAGAGGGATGG - Intronic
1084209954 11:67616256-67616278 ATGGGGACCCAGACGGGGGGCGG + Intergenic
1084242702 11:67833420-67833442 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1084554433 11:69867530-69867552 ATGGAGCATCAGAATGGGGAAGG - Intergenic
1084830299 11:71763584-71763606 TGGGGGAGTCAGAAGGGAGATGG - Intergenic
1085157054 11:74305219-74305241 GGTGGGAGTTAGAAGGGGGAAGG + Intronic
1085579493 11:77637920-77637942 ATGGCGAGGAAGAAGGGGAAGGG - Intergenic
1085684076 11:78605830-78605852 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1085998342 11:81949762-81949784 TTGGGGACTCGGAAGGGGAAGGG - Intergenic
1086049252 11:82569328-82569350 ATGGAAGCTCAGAAGGGGGATGG - Intergenic
1086311504 11:85540490-85540512 ATGGGGAGGCCAGAGGGGGATGG - Intronic
1086464443 11:87038318-87038340 TTGGGGGGTCGGTAGGGGGAAGG + Intronic
1086476084 11:87176267-87176289 ATGGGGAGACAGGAAGGGGCAGG - Intronic
1087335526 11:96839605-96839627 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1087396617 11:97609145-97609167 ATGGGGAGCTGGAAGGGAGATGG + Intergenic
1087396970 11:97611384-97611406 ATGTGGAGCCAGAAAGGGTATGG + Intergenic
1087677090 11:101175682-101175704 GTGGGGAGCCAGAAAGGGGATGG - Intergenic
1087850285 11:103019843-103019865 AAGGGGAGTGAGAAGGAAGAAGG + Intergenic
1087933706 11:104006795-104006817 ATAGGGAGCTGGAAGGGGGATGG - Intronic
1088081592 11:105923049-105923071 CTGGGGGGTTAGAATGGGGAAGG - Intronic
1088103234 11:106177224-106177246 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1088238530 11:107750409-107750431 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1088257748 11:107916796-107916818 ATGTGGAGCCAGAAGGAGGATGG - Intronic
1088450618 11:109977747-109977769 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1088920266 11:114255477-114255499 ACGGGGAGCCAGAGGGAGGAGGG - Intergenic
1089556068 11:119316577-119316599 ATGCCCAGGCAGAAGGGGGAAGG + Intronic
1089629101 11:119772733-119772755 ATGGGGTGGCAGCAGGAGGAGGG + Intergenic
1089668359 11:120034510-120034532 ATGGGGAGAGAGAAGGAGGCAGG - Intergenic
1090124294 11:124069839-124069861 ATGGGGAGCCAGAAGGGGAGCGG + Intergenic
1090135852 11:124198752-124198774 AAGGGGAGCTGGAAGGGGGATGG - Intergenic
1090418116 11:126554996-126555018 ATGAGGAGTTGGAAAGGGGATGG - Intronic
1090554123 11:127855597-127855619 ATGGGGAGCTAGAAAGAGGATGG + Intergenic
1090678912 11:129031994-129032016 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1090818984 11:130323962-130323984 ATGGTGAGTCAGAAGTCAGAAGG - Intergenic
1091174692 11:133547480-133547502 ATAGGGACTCAGAGAGGGGAGGG - Intergenic
1091312446 11:134584405-134584427 GTGGGGAGGCAGCAGGGGGGTGG - Intergenic
1091526713 12:1309596-1309618 AAAGGGAGAGAGAAGGGGGAAGG - Intronic
1091585549 12:1814241-1814263 ATGGGGAGTCTGGAGAGGGTGGG + Intronic
1091663166 12:2399442-2399464 ATGGGGAGCTTGAAAGGGGATGG + Intronic
1091812891 12:3414720-3414742 ATGGGGAGTTGGAAAGGGGATGG + Intronic
1091966146 12:4743539-4743561 ATGGGGAGAGAGGAGAGGGAGGG + Intronic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092236876 12:6815965-6815987 ATGTGGAGGCAGCAGGGAGATGG - Intronic
1092412936 12:8268121-8268143 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1092569987 12:9710847-9710869 TGGGAGAGTCAGAAGGGAGATGG - Intergenic
1092882889 12:12901487-12901509 AAGGGGAGTCAGGAGGAGGACGG - Intronic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093089390 12:14904508-14904530 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1093348953 12:18072635-18072657 ATGGGGAGCCAGAAGGGGAGTGG + Intergenic
1093369695 12:18352721-18352743 ATGGAGAGCTAGAAAGGGGATGG + Intronic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1093474154 12:19536155-19536177 ATGGGGAGTGAGCAGGAAGATGG + Intronic
1093751400 12:22804222-22804244 ATAGGGAGTTGGAAAGGGGATGG + Intergenic
1093769100 12:22998980-22999002 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1093937760 12:25019410-25019432 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094111395 12:26866458-26866480 CTGGGGAGGCTGAAGTGGGAGGG - Intergenic
1094143975 12:27209624-27209646 ATGGAGGCTCAGAAGGGGGAGGG + Intergenic
1094166887 12:27452350-27452372 ATGGAGACTCAGGAGGGTGAAGG - Intergenic
1094174949 12:27531690-27531712 GTGGGGAGTCTGAAAGGGGGAGG + Intronic
1094322101 12:29195858-29195880 ATGGGGACTCAGAAGGACGAGGG - Intronic
1094361734 12:29638400-29638422 ATGGGGATCCAGAAGGGAGATGG - Intronic
1094406473 12:30121538-30121560 ATGGGGAGCCAAAAGGGGGATGG - Intergenic
1094555678 12:31497774-31497796 ATGGGGAGGGTGGAGGGGGAGGG + Intronic
1094583105 12:31752421-31752443 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1094619895 12:32069979-32070001 ATGGGGACTCAGAAGGGTGGCGG - Intergenic
1094816512 12:34191756-34191778 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1095183836 12:39178402-39178424 ATGGGGAGCTGGTAGGGGGATGG - Intergenic
1095184613 12:39187047-39187069 CTGGGGACCCAGAAGGGAGATGG - Intergenic
1095500173 12:42829056-42829078 CTGGGGATCCAGCAGGGGGATGG + Intergenic
1095557914 12:43529640-43529662 TTGGAGACTCAGAAGCGGGAGGG + Intronic
1095748097 12:45682162-45682184 ATGAGGAGGTGGAAGGGGGATGG - Intergenic
1096171667 12:49476346-49476368 TGGGGGAGCCAGAAGGGAGACGG - Intronic
1096414430 12:51401379-51401401 TAGGGGAGCCAGAAGGGAGATGG + Intronic
1096423569 12:51481551-51481573 GTGGGGAGACAGCAGGGGGCAGG + Intronic
1096848768 12:54422022-54422044 ATGGAGAGGAAGAAGGGTGAAGG + Intergenic
1097050427 12:56219907-56219929 CTGAGGAGGCTGAAGGGGGAAGG + Intronic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1097677745 12:62621246-62621268 ATAAGGAGTCAGGAGGGAGAGGG - Intergenic
1097998676 12:65917657-65917679 AGGAAGAGACAGAAGGGGGAAGG + Intronic
1098314879 12:69182519-69182541 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1098396849 12:70028581-70028603 ATGGGGAGCTAGAAGGGGTATGG + Intergenic
1098547969 12:71731965-71731987 TGGGGGAGCAAGAAGGGGGATGG - Intergenic
1098744093 12:74213579-74213601 ACGGGGAGCAGGAAGGGGGATGG + Intergenic
1098757671 12:74386958-74386980 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1098758334 12:74391671-74391693 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1098992733 12:77082433-77082455 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1099029822 12:77512250-77512272 ATGGGCAGGCACAAGGGGGAAGG + Intergenic
1099278567 12:80611260-80611282 ATCAGGAGTCTGAAGGAGGATGG - Intronic
1099509635 12:83517994-83518016 ATGGGAAATCGGAAAGGGGATGG - Intergenic
1099582571 12:84469689-84469711 ATGGAGATTCAAAAGGGTGAAGG + Intergenic
1099653284 12:85456736-85456758 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1099938035 12:89151387-89151409 ATGAAGACTCAGAATGGGGAGGG + Intergenic
1100206373 12:92354412-92354434 ATGGGGAGCCAGCAGGGGGATGG - Intergenic
1100387012 12:94112949-94112971 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1100478119 12:94952737-94952759 ATGAGGAGCCAGAAAGGGGATGG - Intronic
1100641291 12:96484416-96484438 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1101348763 12:103908585-103908607 CTGGGGAGTCTGAGGTGGGACGG + Intergenic
1101362367 12:104040146-104040168 ATGGGGTGGGAGCAGGGGGAGGG + Intronic
1101378039 12:104187853-104187875 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
1101455187 12:104824461-104824483 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1101455761 12:104828288-104828310 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1101469608 12:104984252-104984274 ATGGGGAATAGGAAAGGGGATGG + Intergenic
1101828178 12:108236953-108236975 GAGGGGAGACAGAAGAGGGAAGG + Intronic
1102065475 12:109971564-109971586 TTTGGGAGGCAGAAGGGGGTGGG - Intronic
1102230239 12:111257225-111257247 AAGGGGAGGAAGAAGTGGGAGGG - Intronic
1102230290 12:111257385-111257407 AGGGGGAGGAAGAAGTGGGAGGG - Intronic
1102230297 12:111257404-111257426 AGGGGGAGGAAGAAGTGGGAGGG - Intronic
1102230304 12:111257423-111257445 AGGGGGAGGAAGAAGTGGGAGGG - Intronic
1102230311 12:111257442-111257464 AGGGGGAGGAAGAAGTGGGAGGG - Intronic
1102230318 12:111257461-111257483 AGGGGGAGGAAGAAGTGGGAGGG - Intronic
1102230325 12:111257480-111257502 AGGGGGAGGAAGAAGTGGGAGGG - Intronic
1102275034 12:111575418-111575440 ATGGGGAGGCTGAAATGGGAAGG - Intronic
1102558051 12:113741925-113741947 ATGGAGAGAGAGAAGGGGAAGGG + Intergenic
1102786118 12:115606349-115606371 AAGGGGAGAGAGGAGGGGGATGG + Intergenic
1102813190 12:115841705-115841727 GTGGGAAGAGAGAAGGGGGAAGG - Intergenic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103166251 12:118773088-118773110 ATGGGGAGCGTGAAGGGGGATGG + Intergenic
1103277746 12:119727437-119727459 CTGTGGATTCAGAAGGGGGAAGG + Intronic
1103734732 12:123052986-123053008 CTTGGGAGGCTGAAGGGGGAGGG - Intronic
1104096813 12:125565602-125565624 GTGGGGAGCTGGAAGGGGGATGG + Intronic
1104143132 12:126007153-126007175 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
1104238305 12:126961237-126961259 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1104636458 12:130440555-130440577 GTGGGGAGTCAGGAGGTGAAGGG - Intronic
1104754193 12:131258621-131258643 ATGGGGAGTCGGAAAGCGGAAGG + Intergenic
1104766682 12:131334227-131334249 CTGGGAAGTCATAATGGGGAAGG - Intergenic
1104939499 12:132388242-132388264 ATGGGGGCTCAGAGAGGGGAGGG + Intergenic
1105595158 13:21830613-21830635 AGGGGGAGGGAGAAGGGGAAAGG - Intergenic
1106169854 13:27279754-27279776 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1106182961 13:27383879-27383901 CGGGGGAGCCAGAAGGGAGATGG - Intergenic
1106319457 13:28624353-28624375 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1106694884 13:32162706-32162728 ATTGGCAGCCAGAAGGTGGAAGG - Intronic
1107294389 13:38894320-38894342 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1107459103 13:40584074-40584096 AGGGGGAGACAGATGGGGAATGG + Intronic
1107489988 13:40872515-40872537 ATTGGGAGTGACTAGGGGGATGG + Intergenic
1107854980 13:44606004-44606026 AGGGGAAGTCAGTGGGGGGAGGG + Intergenic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108159056 13:47618897-47618919 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
1108254640 13:48598550-48598572 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1108346422 13:49551125-49551147 GGGGGGAGGGAGAAGGGGGAAGG + Intronic
1108477138 13:50831466-50831488 GTGTGGAGTCAGAAGGGGCTGGG + Intronic
1108687718 13:52835271-52835293 ATGGGGAGGGGGAGGGGGGAAGG + Intergenic
1108738994 13:53315143-53315165 TTGGAGACTCAGAAGAGGGAGGG + Intergenic
1108799810 13:54081728-54081750 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1109075745 13:57832471-57832493 ATGAGGAGACAGAAGGGAGATGG - Intergenic
1109147862 13:58804357-58804379 ATGGGCAGTCAGAAAGTAGATGG + Intergenic
1109151702 13:58856592-58856614 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1109735929 13:66484057-66484079 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1109784546 13:67156553-67156575 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1109940797 13:69361373-69361395 TTGAAGACTCAGAAGGGGGAAGG + Intergenic
1109943635 13:69404518-69404540 GTGGGGAGCCAGAAAGAGGATGG - Intergenic
1110175785 13:72553948-72553970 AAGGGGAGCTGGAAGGGGGATGG + Intergenic
1110334433 13:74310515-74310537 ATGTGGTGTCAGGAGGGAGAAGG + Intergenic
1110484264 13:76019768-76019790 ATGGGGACCCAGAAGGGGCATGG + Intergenic
1110964515 13:81676151-81676173 TGGGGAAGCCAGAAGGGGGATGG + Intergenic
1111073408 13:83200055-83200077 ATGGGGAGCTGGAAGGTGGATGG - Intergenic
1111097640 13:83535587-83535609 TGGGGGAGGCAGAAGGGAGATGG - Intergenic
1111184859 13:84720422-84720444 ATGGGGAGCCAGGAGGGAGATGG - Intergenic
1111206720 13:85020445-85020467 ATGGGTAGCCAGAAGGAGGAGGG - Intergenic
1111262489 13:85760395-85760417 ATGGGGAGCCAGAAGGGGTATGG + Intergenic
1111292180 13:86185013-86185035 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1111292755 13:86188800-86188822 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1111413810 13:87912463-87912485 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1111451818 13:88428810-88428832 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1111878124 13:93921496-93921518 ATGGGGAGCTAGAAAGGGGATGG + Intronic
1112171493 13:96977180-96977202 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1112259765 13:97867666-97867688 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1112559610 13:100501371-100501393 ATGGAGACTCAGAAGGGTGACGG - Intronic
1112705275 13:102061073-102061095 ATGTGGAGCCAGCATGGGGATGG - Intronic
1112929240 13:104714023-104714045 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1113055102 13:106259475-106259497 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1113588316 13:111480780-111480802 ATGGGGAGCCAGAAGAAGGAGGG - Intergenic
1113697218 13:112354922-112354944 GAAGGGAGACAGAAGGGGGAGGG + Intergenic
1113789302 13:113019115-113019137 ATGGGGTGGGAGAAGGGGCAAGG - Intronic
1113890373 13:113732254-113732276 CAGGGAAGTCAGAAGGGAGAGGG - Intronic
1113967829 13:114164392-114164414 AAGGAGAGGCAGATGGGGGAAGG + Intergenic
1114231902 14:20790718-20790740 ATGGGGAGCCAGAAGAGGGAAGG - Intergenic
1114616484 14:24071450-24071472 ATTGGGAGGGAGAAGAGGGAAGG - Intronic
1114996939 14:28365485-28365507 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1115094540 14:29618971-29618993 ATGAGGAGGAGGAAGGGGGAGGG + Intronic
1115123985 14:29971189-29971211 TAGGGGAGCCAGAAGGGCGATGG + Intronic
1115176595 14:30569179-30569201 CTGGGGAGAGAGAAGGGGTAGGG - Intronic
1115320625 14:32076699-32076721 AGGCGGAGGAAGAAGGGGGAGGG + Intronic
1115724511 14:36198502-36198524 AGGGGGAGTCGGGAGGGGGAGGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1115979138 14:39030262-39030284 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1116042001 14:39697407-39697429 TTGGAGACTCAGAAGGGGGGAGG - Intergenic
1116090067 14:40293733-40293755 ATTGGGAATCAGAAGGGGGATGG + Intergenic
1116121122 14:40723210-40723232 ATGGGGAGCTAAAAAGGGGATGG + Intergenic
1116724376 14:48544081-48544103 ATGGGGTGTGGGGAGGGGGATGG - Intergenic
1117046235 14:51816366-51816388 ATGGGAAGCCGGAAGAGGGATGG + Intergenic
1117450564 14:55845706-55845728 AAGGGGAGCTGGAAGGGGGATGG + Intergenic
1117517965 14:56521377-56521399 TTGGAGAGTTAGAAGGGGGAGGG - Intronic
1117740135 14:58809526-58809548 ATGGAGTCTCAGAAGGGTGAGGG - Intergenic
1117943997 14:60998483-60998505 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1118793857 14:69121696-69121718 ATGTGGGGTCAGAAGGAGTATGG + Intronic
1118924417 14:70178951-70178973 ATGAGAAGTCAGTAGGGGGTGGG - Intronic
1118929344 14:70225642-70225664 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1119598968 14:75961809-75961831 ATGGGATGTCACAAGGGAGAAGG - Intronic
1119697666 14:76726530-76726552 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1119702250 14:76762946-76762968 ATGAGGAGCCAGAAGAGGAAGGG + Exonic
1119913314 14:78371372-78371394 AAGGGGAGGTGGAAGGGGGATGG - Intronic
1120128189 14:80772418-80772440 ATGGGGAGCTGGAGGGGGGATGG - Intronic
1120218376 14:81704993-81705015 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1120280463 14:82431747-82431769 ATGGGAAGGCAGAAGGGGGATGG + Intergenic
1120491152 14:85180126-85180148 AAGGGGAGCTAGAAAGGGGATGG - Intergenic
1120763155 14:88304074-88304096 TGGGAGAGTGAGAAGGGGGATGG + Intronic
1121394304 14:93605792-93605814 AGAGGGAGTCCGAAGTGGGAGGG + Intronic
1121666519 14:95676626-95676648 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1121869670 14:97395500-97395522 GTGGCAAGTCAGAAGGGGAAAGG - Intergenic
1121904082 14:97723772-97723794 ATGGGGAGGGAGCAGGGGGTGGG - Intergenic
1122105568 14:99451747-99451769 TTTGGGAGTCTGAAGTGGGAGGG - Intronic
1122292411 14:100686868-100686890 CTGGAGAGGCAGGAGGGGGAGGG + Intergenic
1122322242 14:100862073-100862095 AGGGGGAGGGAGAAGGAGGAAGG - Intergenic
1122371153 14:101229776-101229798 TGGGGGAGCCAGAAGGGAGACGG + Intergenic
1202891188 14_KI270722v1_random:159518-159540 CTGGGGAGTCTGAGGTGGGAGGG + Intergenic
1123809072 15:23905248-23905270 TGGGGGAGCCAGAAGGGTGATGG + Intergenic
1123987444 15:25658075-25658097 ATGGCGGGTCAGAAGTGGCAGGG + Intergenic
1124698373 15:31887670-31887692 ATGAGTAGACAGAAGGGGGATGG + Intergenic
1125446899 15:39767795-39767817 ATGGGGAGCTGGAACGGGGATGG - Intronic
1125998689 15:44188920-44188942 TCGGGGAGTCAGAAGTGGAAGGG + Intronic
1126228298 15:46296475-46296497 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1126322929 15:47444986-47445008 ATGGGGAGCTGGAAGGGGGATGG + Intronic
1126386567 15:48099579-48099601 ATGGGTAGGCAGAAGGAGAAGGG - Intergenic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1127027633 15:54824997-54825019 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
1127714545 15:61636719-61636741 TTGGGGACTCAGAAGGGAGGTGG + Intergenic
1127819581 15:62643313-62643335 ATGGGGAGCCAGAAGTGAGAAGG + Intronic
1127980764 15:64033264-64033286 AGGGGGAGGGGGAAGGGGGAAGG + Intronic
1128046062 15:64618608-64618630 TTGGGGAGCCAGAAGGGAGATGG + Intronic
1128074961 15:64820168-64820190 ATGGGGAATAAGCAGGGGCAGGG + Intronic
1128116784 15:65112515-65112537 ATGGGGAGTGGGATGGGTGAAGG + Intronic
1128183737 15:65626488-65626510 ATGGCGTCTGAGAAGGGGGAGGG + Intronic
1128338411 15:66803143-66803165 ATGGGGAGGCAGGGGGAGGAGGG - Intergenic
1128405716 15:67335736-67335758 CAGGTGAGTCAGAAGGGGAAAGG - Intronic
1128591129 15:68898427-68898449 ATGGAGAGAGAGAAGGGGCAAGG - Intronic
1129684172 15:77675883-77675905 TTGGGGAGCCAGAGTGGGGATGG - Intronic
1129722441 15:77885206-77885228 CTGGGGAGTCAGAGGGGGCTGGG + Intergenic
1130073751 15:80671052-80671074 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130430447 15:83842050-83842072 ATGGGAAGGCAGAAGGGGGATGG - Intronic
1130430479 15:83842219-83842241 ATGAGGAGGCAGAAGGGGGATGG + Intronic
1130550300 15:84886371-84886393 ATGGGAAGGAAGGAGGGGGAGGG + Intronic
1130788799 15:87129525-87129547 GTGGGGAATCAAAAGGGTGAGGG + Intergenic
1130927346 15:88395688-88395710 ATAGGGAGTTAGAAGGGGGATGG + Intergenic
1131014142 15:89043472-89043494 AAGGAGAGGAAGAAGGGGGAGGG + Intergenic
1131177240 15:90217744-90217766 CTGGGGAATGAGAAAGGGGAAGG - Intronic
1131261957 15:90892197-90892219 GTGGGGAATCAGATGGGGCAGGG - Intronic
1131557746 15:93414248-93414270 ATGGGGGGCCAGAAGGGGGACGG + Intergenic
1131646234 15:94348359-94348381 AGGGAGAGAGAGAAGGGGGATGG - Intronic
1131679377 15:94705626-94705648 AGGGAGAGAGAGAAGGGGGAGGG - Intergenic
1133392753 16:5422766-5422788 ATGGAGAGGGAGAAGGGAGAGGG + Intergenic
1133493901 16:6297878-6297900 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1133808772 16:9145267-9145289 ATGGGGAATTGGAAAGGGGATGG - Intergenic
1134346652 16:13397930-13397952 GCGGGGAGCCAGAAGGGAGATGG + Intergenic
1134347975 16:13409216-13409238 ATGGGGAACTGGAAGGGGGATGG - Intergenic
1134449404 16:14354232-14354254 AGGGGGAGGGGGAAGGGGGAAGG + Intergenic
1134712775 16:16336180-16336202 TGGGGGACTGAGAAGGGGGAGGG + Intergenic
1134747348 16:16598543-16598565 TTGGGGAGTCAGAAGCAGGAAGG + Intergenic
1134770605 16:16806050-16806072 AAGGGGAAGGAGAAGGGGGAAGG - Intergenic
1134873680 16:17676191-17676213 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1134954052 16:18372513-18372535 TGGGGGACTGAGAAGGGGGAGGG - Intergenic
1134993654 16:18722497-18722519 ATGGGGAGGGGGAGGGGGGAGGG + Intergenic
1134998123 16:18755115-18755137 TTGGGGAGTCAGAAGCAGGAAGG - Intergenic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135352196 16:21738515-21738537 ATGGGGAGCTAGAAAGGGGATGG + Intronic
1135450686 16:22554637-22554659 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
1135672511 16:24387296-24387318 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
1135674848 16:24406635-24406657 ATGGGGAATTAGAAAGGGGATGG - Intergenic
1135678393 16:24436695-24436717 ATGGGGAGTTGGAAAGGAGATGG - Intergenic
1135939718 16:26810482-26810504 ATGAGGAGGCATAAGGGGGATGG + Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136178517 16:28535111-28535133 CTGGGAAGTGAGATGGGGGAGGG - Intronic
1136220344 16:28823927-28823949 ATGGGGAGTCTGCTGCGGGAAGG + Intronic
1136403491 16:30030703-30030725 CTGGGGAGTCGGGAGGGGGCTGG + Exonic
1136909989 16:34136762-34136784 AGGGGCTGTCAGAAGGGGGTGGG + Intergenic
1137539243 16:49350621-49350643 CTGGGGAGTCGGAGGAGGGAAGG - Intergenic
1137563897 16:49521558-49521580 ATGGGGAGACAGCAGTGGCATGG + Intronic
1137579060 16:49622348-49622370 GTGGGGAGTGAGAATGGGGAGGG - Intronic
1137908446 16:52350916-52350938 AAGGGAAGGCAGAATGGGGAGGG - Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1137986949 16:53117070-53117092 TTGGGGAGTGGCAAGGGGGAAGG + Intronic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1138628827 16:58277017-58277039 ATGGGGTGACAGGAGTGGGATGG + Intronic
1138706935 16:58924788-58924810 TTGGGGAGGCAGAAGTGGGCTGG - Intergenic
1138741742 16:59318603-59318625 ATGGAGATTCTGAAGGGTGAGGG - Intergenic
1139087284 16:63602571-63602593 ATGGGGGGTGAGAATGGGGTTGG + Intergenic
1139170879 16:64628016-64628038 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1139284455 16:65798071-65798093 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1139328051 16:66167103-66167125 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1140324790 16:73991217-73991239 AAGGGGAGTTGGAAAGGGGAGGG + Intergenic
1140339112 16:74139790-74139812 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
1140461749 16:75145729-75145751 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1140564604 16:76026997-76027019 ATGGGGAGCTAGAAAGGGAATGG - Intergenic
1140748141 16:77999146-77999168 ATGGGCAGCCAGAAGGGGGATGG + Intergenic
1141252193 16:82368903-82368925 ATGGGGAGAGAGAGTGGGGAGGG + Intergenic
1141805465 16:86338697-86338719 AGGGGGACTCAGAGGAGGGAGGG - Intergenic
1141982741 16:87560457-87560479 ATGGGGAGTGAGAAGGGGGCAGG + Intergenic
1142034554 16:87855269-87855291 ATGGGGAGGCACAAGGGGGTGGG - Intronic
1142352327 16:89586016-89586038 AGGGGCAGTTAGCAGGGGGAGGG + Intronic
1142641718 17:1288894-1288916 ATGGGGAGTCTGGTGGGGGATGG - Intronic
1142641736 17:1288931-1288953 ATGGGGAGTCCGGTGGGGGATGG - Intronic
1142641745 17:1288950-1288972 ATGGGGAGTCCGGTGGGGGATGG - Intronic
1142641797 17:1289060-1289082 ATGGGGAGTCTGGTGGGGGATGG - Intronic
1142641815 17:1289097-1289119 ATGGGGAGTCCGGTGGGGGATGG - Intronic
1142641824 17:1289116-1289138 ATGGGGAGTCCGGTGGGGGATGG - Intronic
1142666719 17:1467695-1467717 TTGGGGGGTCAGGAGGTGGATGG - Intronic
1142725529 17:1810910-1810932 GTTGGGAGCCAGAAGGGAGATGG - Intronic
1142888611 17:2928809-2928831 ATGGGGAGTCGGAGGGGTGGGGG + Intronic
1142958175 17:3535238-3535260 AGGAGGAGTAAGGAGGGGGAGGG - Intronic
1143292360 17:5840961-5840983 TGGGGGAGTCAGAAGGCAGATGG + Intronic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1144125047 17:12195656-12195678 ATGGGGAGTCGGAAGTGAGTGGG + Intergenic
1144212328 17:13025972-13025994 ATGGGGAGACAGAAAAGGGGAGG - Intergenic
1144292831 17:13842896-13842918 ATGAGGAGTAAGAAGGGGTGGGG - Intergenic
1144300862 17:13922207-13922229 ATGGAAAGCCAGAAGGGGGATGG - Intergenic
1144302859 17:13939090-13939112 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1144320844 17:14117926-14117948 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1144591533 17:16528319-16528341 ATGGGTAATGAGAAAGGGGAGGG + Intergenic
1144604377 17:16652002-16652024 ATAGGGATTCTGAAGGGTGAAGG + Intronic
1144888168 17:18477853-18477875 GTGGGGAGGCAGAATGGGGAGGG + Intronic
1145144038 17:20466450-20466472 GTGGGGAGACAGAATGGGGAGGG - Intronic
1145231546 17:21177000-21177022 ATGAGGAGTCAGAAAGGAAACGG - Intronic
1145353934 17:22119148-22119170 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1146097659 17:29947401-29947423 ATGGAGACTCAGAAGTGGGAGGG + Intronic
1146297955 17:31665054-31665076 ATGAGGTGGGAGAAGGGGGAAGG - Intergenic
1146404216 17:32523242-32523264 ATGGGAAGGCAGGTGGGGGAGGG + Intronic
1146422215 17:32698289-32698311 AGGGGGAGGGAGAGGGGGGAAGG - Intronic
1146614567 17:34344618-34344640 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1147533092 17:41298589-41298611 CGGGGGAGCCAGAAGGGGGATGG - Intergenic
1147906343 17:43825573-43825595 ATGGGGTGGCAGCAGGAGGAGGG - Intronic
1147927379 17:43954004-43954026 AGGGGGAGCCAGCAGGGGGTGGG + Intronic
1148062729 17:44847845-44847867 ATAGGGATGCAGATGGGGGAAGG + Intronic
1148084506 17:44985807-44985829 TGGGGGAGCCAGAAGGGGGATGG - Intergenic
1148161215 17:45451265-45451287 ATGGGCAGCCAGCAGGGGGCAGG + Intronic
1148166871 17:45490169-45490191 TTGGGGAGCTAGACGGGGGATGG + Intronic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1148537768 17:48455162-48455184 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1148752467 17:49953142-49953164 AGGGGGAGTGGGAAGAGGGAGGG + Intergenic
1148852504 17:50561727-50561749 GCGCGGGGTCAGAAGGGGGACGG + Intronic
1148892972 17:50820974-50820996 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1149102947 17:52928009-52928031 ATGGGGAGATGGAAGGGGGTTGG + Intergenic
1149132174 17:53316122-53316144 CAGGGGAGTCAGAAGGGAGATGG + Intergenic
1149217096 17:54370216-54370238 CTGGGGAGTTAGAAGGGGGATGG + Intergenic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1149436923 17:56640854-56640876 ATGGAGAGTCAGTAGGTGAACGG + Intergenic
1149564460 17:57631159-57631181 AGGGGGACTCAGAAAGGGGCTGG - Intronic
1150120725 17:62599512-62599534 ATGGGAAGGCAGAAATGGGAGGG + Intronic
1150392450 17:64797911-64797933 ATGGGTAGCCAGCAGGGGGCAGG + Intergenic
1150854722 17:68741035-68741057 ATAGGGAGCTGGAAGGGGGATGG - Intergenic
1150999025 17:70352137-70352159 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1151464605 17:74276422-74276444 ATGGGGTGACAGAGCGGGGACGG - Intronic
1151597402 17:75087004-75087026 ATGTGGAGTGAGAAGAGGGAGGG + Intergenic
1151661738 17:75522519-75522541 ATGGTGAGTCAGGAGAGGTAAGG + Intronic
1151765393 17:76131017-76131039 ATGGGGAGAAAGAAAGGAGAGGG - Intergenic
1152302025 17:79500621-79500643 ATGGGGAAATTGAAGGGGGAAGG - Intronic
1152629239 17:81402570-81402592 AGGGGCAGTCAGCAGAGGGAGGG - Intronic
1152643225 17:81457769-81457791 CTGGGTAATCAGGAGGGGGAGGG + Intronic
1153681457 18:7504823-7504845 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1153703212 18:7717415-7717437 AAGGGGAGACAAAAAGGGGATGG - Intronic
1153841028 18:9008008-9008030 ATGGGGTGGGGGAAGGGGGAAGG + Intergenic
1153842753 18:9021945-9021967 CTGGGGAGGCTGAAGTGGGAGGG - Intergenic
1153990481 18:10394731-10394753 TGGGGGAGACAGAAGGGAGATGG + Intergenic
1154083855 18:11282863-11282885 TTGGAGACTCAGAAGGGTGAGGG - Intergenic
1154155925 18:11944057-11944079 ATGGGGAGCTGGAAGGGAGATGG + Intergenic
1154200445 18:12296225-12296247 ATGATGAGTCAGGAGGTGGATGG - Intergenic
1154214961 18:12408739-12408761 ATGGAGACTCTGAAGGGTGAGGG + Intronic
1154298665 18:13173761-13173783 ATGGGGAGTCAGTGCGGGAAAGG + Intergenic
1154388619 18:13917607-13917629 ATGGGGAAACAGAAGGGGACAGG + Intergenic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155374478 18:25140646-25140668 ATGGGGAGACAGAGGGGAGAAGG + Intronic
1155703495 18:28778985-28779007 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1155746104 18:29357944-29357966 GTTGGGAGACAGAAGGAGGATGG + Intergenic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1155822119 18:30391101-30391123 ATGGGGAACTAGAAGGCGGATGG - Intergenic
1156338386 18:36188803-36188825 AGGGAGAGTCAGGAGGGAGACGG + Intronic
1156439266 18:37167445-37167467 ATGGGGTGTCAGAAGGGGGATGG + Intronic
1156474723 18:37398249-37398271 GTTTGGAGTCAGAAGGGAGAGGG + Intronic
1156551915 18:38027422-38027444 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1156625823 18:38907123-38907145 ATGGGGATTCAGCAGCGTGATGG + Intergenic
1157410400 18:47458440-47458462 AAGGGGAGACAGAAGAGAGAGGG + Intergenic
1157534976 18:48451469-48451491 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1157858914 18:51124003-51124025 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1157914857 18:51654946-51654968 ATGGGGAGGCGGAGTGGGGAAGG - Intergenic
1158015220 18:52775527-52775549 TGGGGGAGCCAGAAGGGAGATGG + Intronic
1158187861 18:54791942-54791964 ATGGAGAGCCAGAAGGGAGATGG - Intronic
1158369557 18:56784434-56784456 ATGGAGACTCAGAAGGGGAAGGG - Intronic
1158423107 18:57313436-57313458 AAGGGGAGGGGGAAGGGGGAAGG + Intergenic
1159242944 18:65766696-65766718 ATGGGGAGAAGGAAGGGGGGAGG + Intronic
1159328050 18:66949495-66949517 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1159417604 18:68173259-68173281 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1159566412 18:70055995-70056017 AGGGTGTGTCAGAAAGGGGAGGG - Intronic
1159726578 18:71967858-71967880 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1159923387 18:74246717-74246739 ATGGGGAGATAGCAGGAGGATGG - Intergenic
1159923428 18:74246841-74246863 ATGGGGAGATAGTGGGGGGATGG - Intergenic
1160017829 18:75157901-75157923 ATTGGGTATGAGAAGGGGGAGGG - Intergenic
1160237670 18:77098935-77098957 AGGAGGAGTGAGAAGGAGGAGGG - Intronic
1160731293 19:642779-642801 TGTGGGAGTCAGAAGGGGCAGGG - Intronic
1160743566 19:699292-699314 ATGGGGACACAGTAGGGAGAGGG + Intergenic
1161513769 19:4685370-4685392 AGGGAGAGTCAGCAGGCGGAGGG + Intronic
1161821620 19:6533742-6533764 AGGGGGAGGGGGAAGGGGGAAGG - Intronic
1161935431 19:7368931-7368953 AGGAGGAGTCAGCAGGGAGAAGG + Intronic
1162061244 19:8096810-8096832 ATGGGGACTTAGATGGGGTATGG - Intronic
1162178182 19:8847249-8847271 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
1162973199 19:14193477-14193499 CTGGGAAGGCTGAAGGGGGAGGG + Intronic
1163162716 19:15475151-15475173 GTGGAGATTCAGAAGGGTGAGGG + Intronic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1163272525 19:16262757-16262779 CTGGGGAGTCAGAAGTAGGATGG - Intergenic
1163879053 19:19901636-19901658 ATGGGGAAAAAGAAGGGGTAGGG - Intronic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164471785 19:28542228-28542250 TGGGAGACTCAGAAGGGGGAGGG + Intergenic
1164659487 19:29949922-29949944 GTGGGGAGACGGGAGGGGGAGGG + Intronic
1164922742 19:32101799-32101821 ATGGAGACTCAGAAGGGGGTGGG - Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165788759 19:38478215-38478237 GTGGGGAGTCAGGATGGGGGTGG - Intronic
1166169756 19:41019487-41019509 ATGAGGAGTGAGAAGGCTGAGGG - Intergenic
1166356214 19:42229089-42229111 ATGGGGTGGTAGAAGGGTGAGGG + Intergenic
1166602117 19:44105674-44105696 ATGGAGACTCAAAATGGGGAGGG - Intronic
1166621610 19:44306272-44306294 AGGGGGAGCCAGAAGGGAGATGG + Intergenic
1166679689 19:44759028-44759050 CTGGGGGGTCTGAAGGAGGAGGG - Intronic
1166803983 19:45474003-45474025 GAGGGGAGGAAGAAGGGGGATGG - Exonic
1166831571 19:45642504-45642526 AAGAGGACTCTGAAGGGGGAAGG + Exonic
1166864970 19:45830310-45830332 CTGGAGAGGCAGCAGGGGGATGG - Intronic
1167212642 19:48143018-48143040 ATGGGGACAGAGAAGGGGGCTGG + Intronic
1167426814 19:49433870-49433892 TGGGGGGGTCAGGAGGGGGATGG + Intronic
1167579069 19:50331484-50331506 AAGGGGAAGAAGAAGGGGGAGGG - Intronic
1167669139 19:50839458-50839480 CTGGGGAGTCTGAGGGAGGAGGG + Intergenic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
1168309098 19:55451836-55451858 ATGTGGAGACAGAGGGGTGACGG - Intergenic
1168433858 19:56302524-56302546 ACGGGGAGGAAGAAGAGGGAGGG - Intronic
1168709398 19:58490051-58490073 CTGGGGAGGCTGAAGTGGGAGGG - Intronic
1202645244 1_KI270706v1_random:133234-133256 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1202666609 1_KI270708v1_random:126356-126378 CTGGGGAGTCTGAGGTGGGAGGG + Intergenic
925092509 2:1166946-1166968 ATGGAGAGCCAGAAGGGGCATGG - Intronic
925434772 2:3827294-3827316 AAGGGGAGGCAGCAGGGGCAGGG + Intronic
925586373 2:5468706-5468728 ATGGGTAGTCAGGAGGGCAATGG - Intergenic
925591748 2:5516811-5516833 AATGGGAGTCTGAAGTGGGAGGG + Intergenic
925596522 2:5560957-5560979 ATGGTCAGTCACAAGGAGGAAGG + Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925839810 2:7980506-7980528 TGGGGGAGGCAGAAGGGAGATGG - Intergenic
925993915 2:9276308-9276330 CTGGGAAGACAGCAGGGGGAGGG + Intronic
926139263 2:10358738-10358760 TGGGGGAGCCAGAAGGGAGATGG - Intronic
926173709 2:10570278-10570300 ATGGTGAGACAGGAGGAGGAAGG + Intergenic
926464846 2:13175552-13175574 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
926613342 2:14969855-14969877 ATGGGAAGTCAAACTGGGGAAGG + Intergenic
926825503 2:16901800-16901822 TGGGGGAGTCAGAAAGGAGATGG - Intergenic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
926962902 2:18378311-18378333 ATGAGGAGTCAGGAGGAGAATGG + Intergenic
927049808 2:19316193-19316215 TTGGAGAGTCAGAGGGAGGAGGG - Intergenic
927584014 2:24282372-24282394 TGGGGGAGCCAGAAGGGAGACGG - Intronic
927747814 2:25638208-25638230 ATGGGATGGCAGGAGGGGGAGGG + Intronic
927916302 2:26938839-26938861 CAGGGGAGTCAGGTGGGGGAGGG - Intronic
927925467 2:27010369-27010391 ATATGGAGTCTGAAGGGGGATGG + Intronic
928017827 2:27674945-27674967 TTTGGGAGGCTGAAGGGGGATGG - Intronic
928158232 2:28895383-28895405 AAGGGGGGGCAGGAGGGGGAAGG - Intronic
928308829 2:30193469-30193491 CTAGGGAGGCAGCAGGGGGAGGG - Intergenic
928363571 2:30684947-30684969 CTGGGGAGTGGGGAGGGGGAAGG + Intergenic
928494026 2:31813456-31813478 ATGGGGAGCTAGAAAGTGGATGG + Intergenic
928589923 2:32803519-32803541 CTGGGGAGACAGAAGTGGGTTGG - Intronic
928664492 2:33537119-33537141 ATGGGGAGCTGGAAAGGGGATGG + Intronic
928819341 2:35342186-35342208 ATGGGGAGCCAGAAGGGAGATGG - Intergenic
928869662 2:35961502-35961524 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
928924968 2:36568163-36568185 AGGGAGAGACAGAAGGGGTAGGG + Intronic
929107383 2:38377753-38377775 ATGGGGAGAGAGGAGGGGAATGG - Intergenic
929222457 2:39478492-39478514 ATGGGGAGGAAGCAGGGGTATGG + Intergenic
930084025 2:47480134-47480156 ATGGGGGATGGGAAGGGGGAGGG - Intronic
930297943 2:49578887-49578909 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
930395216 2:50814375-50814397 TTGGGGAATGAGAAGGGGTAAGG - Intronic
930463176 2:51710059-51710081 GTGGAGACTCAGAAGGGTGAGGG + Intergenic
930717799 2:54609076-54609098 AAGGGGAGGCAGAAGAGGCAGGG + Intronic
930752261 2:54945224-54945246 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
930752270 2:54945254-54945276 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
931152010 2:59585017-59585039 AGGGGGAGTAAGAAGAAGGAGGG + Intergenic
931470164 2:62531652-62531674 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
931978248 2:67666686-67666708 AGGGAGAGTAAGAAGGGGAAGGG + Intergenic
932427139 2:71645285-71645307 TTGGGGAGCCAGAAGGGAGATGG + Intronic
932824065 2:74924475-74924497 ATGGGGTGGCAGAACTGGGAAGG + Intergenic
932827269 2:74953025-74953047 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
932830022 2:74980325-74980347 ATGCTGAGGCAGAAGGGGCATGG + Intergenic
932875062 2:75442793-75442815 TTGGAGATTCAGAAGTGGGAAGG + Intergenic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
932893065 2:75612621-75612643 ATGGGGAGCCAGATGGGTGAGGG - Intergenic
933140894 2:78792221-78792243 ATGGGGAGCCAGATGAGGGATGG + Intergenic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933285826 2:80383614-80383636 ATTGTGAGTTAGAAGGGGAATGG + Intronic
933294827 2:80477515-80477537 ATGGAGACTCAGAATGGGAAAGG - Intronic
933425949 2:82112540-82112562 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
933858364 2:86441160-86441182 CCCGGGAGTCGGAAGGGGGAGGG + Intronic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
933947466 2:87299002-87299024 AAGGAGAGACAGAAGGGGCATGG - Intergenic
934121425 2:88843923-88843945 ATAGGGAGGCAGATGAGGGAAGG - Intergenic
934507649 2:94906820-94906842 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
934583599 2:95468131-95468153 ATGGTGTGCCAGAAGGGGGATGG + Intergenic
934595853 2:95608583-95608605 ATGGTGTGCCAGAAGGGGGATGG - Intergenic
934785222 2:97000223-97000245 GTGGGGAGGCTGAAGTGGGAGGG - Intronic
934786921 2:97016905-97016927 ATGGTGTGCCAGAAGGGGGATGG + Intronic
934791760 2:97068090-97068112 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
934913338 2:98278544-98278566 ATGGAGAGCTAGAAAGGGGATGG + Intronic
934957063 2:98631674-98631696 TGGGGGAGCCAGAAGGGAGATGG - Intronic
935081085 2:99795373-99795395 CTGGGGACTCAGAAGGGCAATGG + Intronic
935138819 2:100333142-100333164 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
935206485 2:100901097-100901119 ATGGGGAGGTAGAAGGAGGGAGG - Intronic
935227058 2:101061821-101061843 ATGGGGAGCCTGAAGGGCCAGGG - Intronic
935543659 2:104378278-104378300 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
935663998 2:105494506-105494528 TGGGGGAGCCAGAAGGGTGATGG + Intergenic
935958172 2:108399242-108399264 ATGGGGAGGTAGCAAGGGGATGG - Intergenic
936332729 2:111562565-111562587 AAGGAGAGACAGAAGGGGCATGG + Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
936835394 2:116703601-116703623 ATGGGGAGTGAGTAGAGGGAAGG - Intergenic
937316181 2:120933390-120933412 ATGGGGAGACAAATGGGGCAGGG + Intronic
937474620 2:122204105-122204127 TTGGGGAGTCACAATGGGGCAGG + Intergenic
937508898 2:122570722-122570744 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
937509998 2:122584425-122584447 ATGGGGTGGGGGAAGGGGGAGGG + Intergenic
937651892 2:124328487-124328509 CTGGGGTGTGAGAAGGGAGAAGG - Intronic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
937820760 2:126308084-126308106 CGGGGGAGCCAGAAGGGAGATGG + Intergenic
937942947 2:127302400-127302422 ATGGGAAGGAAGAAGGGGAAAGG - Exonic
938150701 2:128879967-128879989 AAGGGGAGTTGGAAAGGGGATGG + Intergenic
938288447 2:130137059-130137081 AGGGGGAGTCAGAAGAGGGGAGG - Intergenic
938364392 2:130723338-130723360 ATGGGGTGGGAGAAGGGGGGAGG - Intergenic
938427137 2:131201831-131201853 AGGGGGAGTCAGAAGAGGGGAGG + Intronic
938468081 2:131535877-131535899 AGGGGGAGTCAGAAGACGGGAGG + Intergenic
939172482 2:138711726-138711748 ATGGGCAGTCAGGAGCTGGAGGG - Intronic
939451164 2:142376416-142376438 ATGGGGAGCCAAAAGGTGGATGG - Intergenic
939531232 2:143364392-143364414 AGTGGGAGTGAGAAGTGGGAGGG + Intronic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
939829376 2:147053937-147053959 ATGGGGAGCTGGAAGTGGGATGG - Intergenic
939885957 2:147682049-147682071 ATAGGGTGTAAGGAGGGGGAGGG - Intergenic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
940658698 2:156520057-156520079 ATGGGGAGCTGGAAAGGGGATGG + Intronic
940660014 2:156534120-156534142 ATGGGGAGCTAGAAAGGGGATGG + Intronic
940856474 2:158732258-158732280 AGGGGCATTCAGAAGGGGCATGG - Intergenic
941106840 2:161364080-161364102 TGGGGGAGCCAGAAGGGAGATGG + Intronic
941309619 2:163912599-163912621 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
941629249 2:167865968-167865990 ATGGGGAGGAGGATGGGGGAGGG - Intergenic
941717529 2:168779713-168779735 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
941974398 2:171386998-171387020 TTGGGGAGTCAGAAGGGAGATGG - Intronic
941990567 2:171552421-171552443 ATGGGGAGACAGAAGAAGGGAGG - Intronic
941998148 2:171621057-171621079 ATGGGGAATTTGAAAGGGGATGG + Intergenic
942139603 2:172964774-172964796 ATGGGGTGAGAGAAGGGGGCAGG - Intronic
942222503 2:173784239-173784261 ACGGGAACTCAGCAGGGGGATGG + Intergenic
942431837 2:175920295-175920317 ATGGGGTGGGGGAAGGGGGAGGG + Intergenic
942983174 2:182106525-182106547 ATGGGGAGCCAGAAGTGGGATGG - Intronic
943453277 2:188072548-188072570 ATGGGGAGCCAGAAAGAGGTTGG - Intergenic
943474789 2:188340812-188340834 AAGGGGAGTTGGAAAGGGGAGGG + Intronic
943838878 2:192552264-192552286 TTGGGGAGCCAGAAGAGGGATGG + Intergenic
943943249 2:194025694-194025716 ATGGGGTGGGAGGAGGGGGAAGG + Intergenic
944024146 2:195143389-195143411 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
944058688 2:195548699-195548721 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
944586640 2:201178869-201178891 AATGGGAGGCAGAAGGGGGCAGG + Intergenic
944845483 2:203663955-203663977 TTGGGGAGGCTGAAGGGGGCAGG - Intergenic
945047979 2:205798692-205798714 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
945075774 2:206038066-206038088 ATGAAGACTCAGAAGGGTGACGG + Intronic
945428774 2:209739795-209739817 AAGGGGAGTCAGAAAGGACAAGG + Intergenic
945762831 2:213935457-213935479 ATGGGAAGAAAGAAGGGGCAAGG - Intronic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946056768 2:216909778-216909800 ATGGGGAAACAGAAGGGAGATGG - Intergenic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946215953 2:218183790-218183812 ATGGGGAGTTGAAAAGGGGATGG + Intergenic
946602755 2:221370211-221370233 ATTGGGAGGCTGAAGTGGGAGGG + Intergenic
946609397 2:221441440-221441462 ATGGGGAGCTGGAAAGGGGAAGG - Intronic
946719617 2:222590364-222590386 ATGGGGTGGGGGAAGGGGGAGGG + Intronic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
947448877 2:230186660-230186682 ATGGAGACTCAGAAAGGAGAGGG - Intronic
947708508 2:232295277-232295299 ATGGGGAGTGTGATGGGGGAAGG - Intronic
948008258 2:234629063-234629085 ATGGGGAGCTGGGAGGGGGATGG - Intergenic
948208291 2:236174229-236174251 ATGGGGAGTGAGAATTGGAATGG + Intergenic
948302665 2:236919758-236919780 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
948326824 2:237128426-237128448 ATGGGGTGGCGGGAGGGGGAGGG + Intergenic
948525361 2:238567759-238567781 AGGGGAAGTCAAAAGGGGGATGG - Intergenic
948586107 2:239020764-239020786 AGAGGGAGGCAGGAGGGGGACGG - Intergenic
948948285 2:241232974-241232996 CTGGGGAGGAAGAAGGGGAAGGG + Intronic
949082964 2:242120017-242120039 AGGGGGGGTCAGGAAGGGGATGG + Intergenic
1168771122 20:417617-417639 ATGGTGAGTGAGGAGGCGGAGGG + Exonic
1168916081 20:1489557-1489579 AAGGGGACTCAGAAGGGGAGAGG - Intronic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169178619 20:3542548-3542570 AAGGGGAGGTGGAAGGGGGAAGG - Intronic
1169323214 20:4652615-4652637 ATGGAGACTCAGAAGTGGGGAGG - Intergenic
1169440128 20:5626927-5626949 AAGGGGAGCCAGAAGGGGGATGG - Intergenic
1169612105 20:7392986-7393008 ATGGGGAGCCAGATAGGGCAAGG - Intergenic
1169634862 20:7678160-7678182 ATGGGGTGGGAGGAGGGGGAAGG + Intergenic
1170184763 20:13576192-13576214 ATTCCGAGACAGAAGGGGGAGGG + Intronic
1170270972 20:14527037-14527059 TGGGGGAGCCAGAAGGGAGATGG + Intronic
1170519441 20:17168825-17168847 GTGGGAGGTCAGGAGGGGGAAGG - Intergenic
1170557787 20:17529428-17529450 ATTGGGAGACAGAGGTGGGAAGG - Intronic
1170639472 20:18138568-18138590 ATGGAGAGTGAGTACGGGGAAGG - Intronic
1170670309 20:18426721-18426743 ATGGGGTGTGGGAAGGTGGAGGG + Intronic
1170834059 20:19868691-19868713 TTGGGGACCCAGAAAGGGGAAGG + Intergenic
1170984042 20:21242223-21242245 ATAGGGAGTCAGAAGTGGGAAGG + Intronic
1171211566 20:23321011-23321033 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1171564190 20:26163273-26163295 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1171778495 20:29394603-29394625 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1171822552 20:29867053-29867075 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1171895207 20:30752154-30752176 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1172056091 20:32155278-32155300 CTGGGGACTCAGAAAAGGGAAGG - Intronic
1172408752 20:34707263-34707285 AAAGGGGGTCAGAGGGGGGAGGG + Intronic
1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG + Exonic
1172566633 20:35935667-35935689 ATGAGGATTCAGAAGGGACAAGG - Intronic
1172585177 20:36078166-36078188 TTGGGGAGCCAGAAGGGAAATGG + Intergenic
1172841483 20:37904855-37904877 ATGGTGAGGCAGAAGGGGGCGGG - Intronic
1173002048 20:39111647-39111669 AAGGGGAGGAGGAAGGGGGAGGG + Intergenic
1173046627 20:39518810-39518832 ATGGAATGTCAGAAGGGGGCTGG - Intergenic
1173059618 20:39648747-39648769 TTGGAGATTCAGAATGGGGAGGG + Intergenic
1173131946 20:40402194-40402216 ATGGGGAGTCAGAAGAAGTAAGG - Intergenic
1173144553 20:40513519-40513541 ATGGGGAGGCAGAGTGGGGCTGG - Intergenic
1173369928 20:42426417-42426439 ATGGGGAGGTGGAAAGGGGATGG - Intronic
1173389955 20:42623063-42623085 ATGGGGAGCTAGAGGGGGAATGG - Intronic
1173493859 20:43504907-43504929 ATGGGGAAACAGAAGGGGAATGG - Intergenic
1173837657 20:46136344-46136366 ATTGGGGGTCAGGAGGAGGAAGG + Intergenic
1173876630 20:46376415-46376437 AGGGAGAGTCAGGAGGGAGAGGG - Intronic
1173928869 20:46801554-46801576 AGGGAAAGTCAGATGGGGGAGGG + Intergenic
1174021749 20:47535852-47535874 ATGGGGAGCCATAAGAGGGATGG + Intronic
1174046112 20:47735060-47735082 ATGGGAATTCAGAGGGGGCATGG - Intronic
1174078762 20:47956482-47956504 GAGCGGAGTCAGCAGGGGGAGGG + Intergenic
1174118536 20:48244841-48244863 ATGGTGGATGAGAAGGGGGATGG - Intergenic
1174707047 20:52667671-52667693 AGGGGGAATGAGAAGGTGGAGGG - Intergenic
1174761417 20:53210409-53210431 ATGAGGAGTTGGGAGGGGGATGG + Intronic
1174812387 20:53658066-53658088 ATGGGAAGAAAGAAGGGGGAAGG + Intergenic
1174894546 20:54434908-54434930 TTGGGGAGTCAGGAGGGTCAGGG - Intergenic
1175237592 20:57525245-57525267 AAGGGGAGTAGGGAGGGGGAGGG + Intronic
1175259442 20:57665313-57665335 ATAGGAACTCAAAAGGGGGAAGG + Intronic
1175315837 20:58045982-58046004 ATGGGGCCTCAGGAGGAGGAAGG - Intergenic
1175641417 20:60633608-60633630 CTGGGGAGTCAGAAGAGGAGGGG + Intergenic
1175774147 20:61642307-61642329 ATGGGGAACCAGCAGGTGGATGG + Intronic
1175891472 20:62317885-62317907 ATGGGGGGTGAGGAGGGGGGAGG + Intronic
1176071812 20:63230881-63230903 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1176239173 20:64067995-64068017 AAGGGGAGGCAGAGGAGGGAGGG - Intronic
1176389172 21:6154821-6154843 AGGGGGGCTCAGGAGGGGGACGG + Intergenic
1176724275 21:10417090-10417112 ATGGGGAGTCAGATTGTGCAGGG + Intergenic
1176981525 21:15386790-15386812 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1177339526 21:19782149-19782171 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1177647443 21:23917696-23917718 ATGGGGAGCTGGAAGGGGGCTGG - Intergenic
1178195815 21:30344281-30344303 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1178199831 21:30390911-30390933 GTGGGGAGCTAGAAGGGGGATGG - Intronic
1178213738 21:30569208-30569230 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1178384524 21:32138435-32138457 ATGGGGATCCAGAAGGGGGTTGG - Intergenic
1178422361 21:32452707-32452729 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1178438671 21:32581278-32581300 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1178514279 21:33232743-33232765 AAGGTGAGTGAGATGGGGGAAGG + Intronic
1178755710 21:35347479-35347501 TTGGGGACTCAGAAAGGTGAGGG - Intronic
1178917265 21:36713055-36713077 TTGGGGAGAGAGAATGGGGAGGG + Intronic
1179007579 21:37529028-37529050 ATGGGGAGACAGCAGGGGAGGGG - Intergenic
1179095916 21:38314340-38314362 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
1179342283 21:40523573-40523595 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1179734300 21:43383427-43383449 AGGGGGGCTCAGGAGGGGGACGG - Intergenic
1179818993 21:43925525-43925547 GTGGGTAGACAAAAGGGGGAGGG + Intronic
1180256978 21:46636152-46636174 AAGGGGGGTGAGAAGGGGGCAGG - Exonic
1180324268 22:11354597-11354619 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
1180356715 22:11849210-11849232 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1180381546 22:12143121-12143143 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1180930439 22:19586914-19586936 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1181317232 22:21978598-21978620 AGGGTGAGTCAGGAGGGGTAAGG + Intronic
1181471526 22:23143181-23143203 TTTGGGAGGCTGAAGGGGGAGGG + Intronic
1182110773 22:27721687-27721709 AGGGGAAGTGAGAAGGGGTAGGG - Intergenic
1182329836 22:29543380-29543402 ATGGGGAGGAGGAAGGAGGAAGG + Intronic
1182351676 22:29703285-29703307 CTGGCGAGTGAGGAGGGGGAAGG - Intergenic
1182876360 22:33694707-33694729 GTGGAGAGACAGGAGGGGGAAGG + Intronic
1182935515 22:34218305-34218327 ATGAGGAGTCAGAGGCAGGAGGG - Intergenic
1183119562 22:35719905-35719927 ATGGGGAGCCAGAAAGGGGATGG + Intronic
1183153116 22:36053602-36053624 ATGGGAAGGGAGAAGGGAGAAGG - Intergenic
1183281737 22:36935985-36936007 ATGGGGTGTCAGGAGGCAGAAGG + Intronic
1183731761 22:39622358-39622380 ATGGGGATTGAGTAGGTGGAGGG + Intronic
1184064072 22:42105963-42105985 ATTGGGAGCCAGAAGCTGGATGG + Intergenic
1184343440 22:43898725-43898747 GTGGGGAGTGATAAGGAGGAGGG + Intergenic
1184345768 22:43911732-43911754 ATGGGGAGACCAAAGAGGGATGG - Intergenic
1184490833 22:44807870-44807892 ATGAGAAGTCAGAGGGCGGAAGG - Intronic
1184934172 22:47706934-47706956 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1184950670 22:47840529-47840551 CTGGGGAGGCAGAAAGGGGCAGG - Intergenic
1185075161 22:48679024-48679046 CTGGGGAGCCAGGAGAGGGATGG - Intronic
1185075228 22:48679216-48679238 CTGGGGAGCCAGGAGAGGGATGG - Intronic
1185075239 22:48679247-48679269 ATGGGGAGCCGGGAGAGGGATGG - Intronic
1185075248 22:48679270-48679292 ACGGGGAGCCGGAAGAGGGATGG - Intronic
1185075425 22:48679730-48679752 CTGGGGAGCCAGGAGAGGGATGG - Intronic
1185088590 22:48753712-48753734 ACGAGGAGTCAGGAGGTGGAGGG + Intronic
1185106384 22:48872171-48872193 ATGGGGAGGCAGGAGGGACAGGG - Intergenic
1185244918 22:49768374-49768396 GTGGGGAGTCAGAGGAGGCAGGG + Intergenic
949243659 3:1900251-1900273 ATGGGAAATAAGAAGGGGTAGGG + Intergenic
949437982 3:4049896-4049918 ATGGGGAGCTGGAAGGGGGATGG + Intronic
949617521 3:5770319-5770341 GATGGGAGCCAGAAGGGGGATGG + Intergenic
949689667 3:6621295-6621317 ATGGGGAATTGGAAAGGGGATGG - Intergenic
949789334 3:7775811-7775833 ATGGGTAGTCAGAAGTAGGTAGG + Intergenic
949808031 3:7976732-7976754 ATGTGGAGCCAGAAGGGGGATGG - Intergenic
949931638 3:9083142-9083164 ATGGGGAAACATCAGGGGGAGGG - Intronic
949988917 3:9561088-9561110 ATGAAGAGTCAGAAGGGCGAGGG - Intergenic
950019498 3:9777123-9777145 AGGGTGAGTGAGAACGGGGAGGG - Intronic
950056814 3:10031697-10031719 AAGGGTAGACAGAATGGGGAAGG - Intronic
950085553 3:10254998-10255020 AGGGGGAGTGGGAAGTGGGAAGG - Intronic
950552722 3:13676383-13676405 ATCGGGGGTCAGAAGGGAGAGGG + Intergenic
950578706 3:13849074-13849096 CTGGGGATTCGGAAGGGGAAGGG + Intronic
951004353 3:17599455-17599477 ATGGGGAGCTGGAAAGGGGATGG - Intronic
951719186 3:25679747-25679769 AGGGGGAGAGAGGAGGGGGAAGG + Intergenic
951907251 3:27717454-27717476 ATGGGATGTCTGAAGGGGCAAGG + Exonic
952002986 3:28808611-28808633 ATAGGGAGCCAGAAGGGGGTTGG + Intergenic
952003338 3:28810859-28810881 ATAGGGAGCCAGGAGGGGGATGG + Intergenic
952039212 3:29241318-29241340 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
952580259 3:34824564-34824586 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
952641651 3:35603800-35603822 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
952643374 3:35625390-35625412 TTGGAGACTCAGAAGTGGGATGG - Intergenic
952749202 3:36811533-36811555 TTAGGGACTCAGAAGGTGGAGGG + Intergenic
953088387 3:39697469-39697491 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
953106404 3:39884929-39884951 ATAGGGAGGGAGAAGGGGGGTGG - Intronic
953277297 3:41514762-41514784 ATGGAGACTCAGAAGGGTGAGGG + Intronic
953345477 3:42171964-42171986 ATGGGGACGGAGAGGGGGGATGG - Intronic
953380464 3:42467520-42467542 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
953472297 3:43177627-43177649 CAGGGGAGTCAGAGGGGGGGGGG - Intergenic
954105331 3:48406747-48406769 AGGGGCAGTGTGAAGGGGGAAGG + Intronic
954131622 3:48564027-48564049 ATGGGGGGTTTCAAGGGGGAAGG - Intergenic
954411579 3:50373518-50373540 AGGGGGAGGGAGGAGGGGGATGG + Intronic
954794225 3:53153345-53153367 GTGGGGAGGCAGAGGGAGGAAGG + Intergenic
954911098 3:54110639-54110661 ATGATGAGTGAGAAGAGGGAAGG - Intergenic
955019541 3:55105979-55106001 ATGGAGAGTCAGCCTGGGGAGGG + Intergenic
955032548 3:55234811-55234833 TTGGAGACTCAGGAGGGGGATGG - Intergenic
955946918 3:64204235-64204257 ATGGGAGGTCAGGATGGGGAGGG + Intronic
956031075 3:65038772-65038794 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
956181141 3:66519145-66519167 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
956194113 3:66635087-66635109 TCGGGGAGCCAGAAGGGAGATGG - Intergenic
956214210 3:66831833-66831855 AAGGGTGGGCAGAAGGGGGAAGG - Intergenic
956390830 3:68771106-68771128 ATGGGGAGTCAGAAGGGGGATGG - Intronic
956541436 3:70344417-70344439 ATGGGGAACTGGAAGGGGGATGG - Intergenic
956689282 3:71861105-71861127 ATGGGGAGCCTGAAGGGGGATGG - Intergenic
956735276 3:72233254-72233276 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
957029275 3:75221396-75221418 GACGGGAGCCAGAAGGGGGATGG + Intergenic
957586530 3:82139413-82139435 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
957758413 3:84522776-84522798 ATGGGGAGCTAGAAAGGGGATGG - Intergenic
957804404 3:85128580-85128602 ATGACAAGTCAGAAGGTGGAAGG + Intronic
957890320 3:86348788-86348810 GTGGGTAGTCAGAGGGTGGAAGG - Intergenic
958001956 3:87761837-87761859 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
958028884 3:88083018-88083040 AGGAGGAGTGAGGAGGGGGAGGG - Intronic
958074500 3:88658239-88658261 ATGGGGAGCCAGAAGGCGGATGG + Intergenic
958168956 3:89914834-89914856 ATGAGGAGGTAGAAAGGGGATGG + Intergenic
958632310 3:96700006-96700028 ATGGGGAGTCAGAAGGGATAGGG - Intergenic
958663712 3:97106515-97106537 TGGGGAAGCCAGAAGGGGGATGG - Intronic
959065213 3:101648982-101649004 ATGGGGAGCTGGAAAGGGGATGG + Exonic
959164387 3:102758731-102758753 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
959269733 3:104192337-104192359 AGGGGGAGCCAGAAGGGAGATGG + Intergenic
959375512 3:105584334-105584356 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
959539603 3:107523961-107523983 AAGGGGAGAGAGAAGAGGGAGGG + Intronic
960023949 3:112987816-112987838 TAGGGGAGCCAGAAGGGAGATGG + Intergenic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960501609 3:118445051-118445073 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
961082282 3:124036579-124036601 ATGGGAAATCAGAAGGGAGAAGG - Intergenic
961345286 3:126260116-126260138 ATGTGGAGAGGGAAGGGGGAGGG - Intergenic
961345503 3:126260850-126260872 ATGGGGAGAAAGAAGAGGGAAGG - Intergenic
961445362 3:126978122-126978144 ACGGGAAGTCAGAGGGAGGAGGG + Intergenic
961603675 3:128078191-128078213 ATGGGGGTACAGAAGGGGGCTGG - Intronic
961880221 3:130056495-130056517 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
961880586 3:130058798-130058820 GTGAGGTGTCAGAAGGAGGAAGG - Intergenic
961890500 3:130126774-130126796 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
962095098 3:132285166-132285188 TGGGGGAGCCAGAAGGGAGATGG + Intronic
963008749 3:140750141-140750163 ATAGGGACTCAAAAGGGTGAAGG + Intergenic
963102832 3:141622727-141622749 ATGGGGAGCTGAAAGGGGGATGG - Intergenic
963234713 3:142945532-142945554 ATGGGGAGGTGGAAGGGGGATGG + Intergenic
963655899 3:148049711-148049733 ATGGGGAGATAGAAAGGGGATGG - Intergenic
963688658 3:148470863-148470885 ATGGGGAGTAATAATGGAGAAGG + Intergenic
963938861 3:151081426-151081448 AGGGGGAGGGGGAAGGGGGAGGG - Intergenic
964136577 3:153351532-153351554 ATGGGGAGTTGGAAGGGGGATGG + Intergenic
964215824 3:154280672-154280694 ATGGGGGGTGAGAAGGTAGAGGG + Intronic
964355364 3:155846787-155846809 ATGGGGAGACAGAGGTGAGAAGG - Intronic
964669466 3:159209345-159209367 AAGGGGAGCCGGAAGGGGGATGG - Intronic
965085319 3:164088750-164088772 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
965185275 3:165454898-165454920 ACTGGGAGCCAGAAGGGGGATGG + Intergenic
965300827 3:167002553-167002575 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
965321020 3:167251168-167251190 TGGGGGAGCCAGAAGGGAGATGG - Intronic
965535010 3:169814206-169814228 ATGGGGAGCCAGAAAGGGAATGG + Intergenic
967501043 3:190197735-190197757 AAGGGGAGAAAGAAGGGGAAAGG + Intergenic
968261096 3:197324771-197324793 ATCAGGAGTCAGAAGGGGCCAGG + Intergenic
968261104 3:197324794-197324816 ATTGGGAGGCAGAAGGGGCCAGG + Intergenic
968261119 3:197324840-197324862 ATTGGGAGGCAGAAGGGGCCAGG + Intergenic
968741726 4:2334737-2334759 AAGGGGAGGGGGAAGGGGGAGGG - Intronic
968960883 4:3743080-3743102 GTGGGGAGTTGGATGGGGGAAGG - Intergenic
968966319 4:3770739-3770761 ATGGGGTGCCAGCATGGGGAGGG + Intergenic
968978660 4:3835053-3835075 ATGGAGAGAGAGAAGAGGGAAGG + Intergenic
968992610 4:3924850-3924872 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
969122535 4:4920593-4920615 ATGGGGTGGCAGACGGGGAAGGG - Intergenic
969489318 4:7490254-7490276 AGGCCGAGTCAGAAGGGAGATGG - Intronic
969571386 4:8010741-8010763 ATGGAGAGGCAGAGGGGGCAGGG + Intronic
969752119 4:9119346-9119368 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
969822741 4:9732772-9732794 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
970046641 4:11861847-11861869 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
970054648 4:11957219-11957241 TGGGGGAGACAGAAGGGAGATGG + Intergenic
970106235 4:12588416-12588438 AGAGGGAGTTAAAAGGGGGATGG - Intergenic
970221422 4:13815836-13815858 ATGGAGACTCAGAAGGGTGTGGG - Intergenic
970234437 4:13944477-13944499 ATGGGGAGCCAGAAGGGAGATGG - Intergenic
970234486 4:13944768-13944790 TGGGGGAGTCAGAAGGAAGATGG + Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970500443 4:16671651-16671673 ATTCGGAGTCAGAAGGGGCCAGG + Intronic
970576462 4:17433561-17433583 TTAGGCACTCAGAAGGGGGAAGG + Intergenic
971005476 4:22370002-22370024 AAGGGGAGCCAAAAAGGGGATGG - Intronic
971185477 4:24371643-24371665 ATGGAAAGTCAGTAGGGGCAGGG + Intergenic
971393714 4:26209662-26209684 AGGGGGAGACGGAAGGAGGAAGG - Intronic
971502062 4:27328366-27328388 ATGGGAAGCTGGAAGGGGGATGG + Intergenic
971840239 4:31842198-31842220 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
971887598 4:32473406-32473428 ATGGCGAGCCAGAAGAGGGATGG + Intergenic
971986915 4:33837988-33838010 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
972390251 4:38607010-38607032 ATGGGGAGTCAGAAGGGGGATGG + Intergenic
972805009 4:42520538-42520560 ATGGAGAGCGAGAAGGTGGAGGG + Intronic
973621314 4:52728843-52728865 ATGCGGGGTTAGAAAGGGGAAGG - Intronic
974012277 4:56617832-56617854 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
974032797 4:56790990-56791012 ATGGAGACTCAGAAGAGGGAGGG - Intergenic
974121118 4:57640316-57640338 ATGGGGAGCCGGAAGGTGAAGGG - Intergenic
974166839 4:58214892-58214914 ATGGGGAGTGGGAAGGACGATGG + Intergenic
974169302 4:58245561-58245583 ATGGGGAGCTTAAAGGGGGATGG - Intergenic
974250097 4:59374902-59374924 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
974303289 4:60098155-60098177 ATGGGGAGCCAGAAGAGGAATGG - Intergenic
974368639 4:60985699-60985721 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
974993970 4:69129407-69129429 TGGGGGAGCCAGAAAGGGGACGG - Intronic
975290482 4:72672115-72672137 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
975460863 4:74651285-74651307 AGGGGGAGGGAGGAGGGGGAGGG + Intergenic
975460870 4:74651298-74651320 AGGGGGAGGGAGGAGGGGGAGGG + Intergenic
975460877 4:74651311-74651333 AGGGGGAGGGAGGAGGGGGAGGG + Intergenic
975580909 4:75906346-75906368 ATGGGGAGCTGGAACGGGGACGG - Intergenic
975707065 4:77121887-77121909 ATGGGGAATTGGAAAGGGGATGG + Intergenic
975891368 4:79032631-79032653 ATGGAGAGGCAGAGGTGGGAGGG + Intergenic
976042031 4:80898264-80898286 ATGGGGAGTTGAAAAGGGGATGG + Intronic
976070635 4:81236081-81236103 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
976108118 4:81641225-81641247 ATGGGGATTCTGGAGGTGGATGG - Intronic
976171927 4:82313263-82313285 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
976828263 4:89284184-89284206 ATGGGGAGTCAGCCAGGTGAAGG + Intronic
977441200 4:97070342-97070364 ATGGGCAGCTGGAAGGGGGATGG - Intergenic
977756949 4:100682782-100682804 CAGGGGAGCCAGAAGGGAGATGG - Intronic
977910285 4:102526325-102526347 ATGGAGATTCAGAAAGGTGAGGG + Intronic
978310141 4:107378655-107378677 ATGGGGAGACAGTAGGGGGATGG + Intergenic
978414784 4:108463778-108463800 ATGGGGAGCCAGAAGGGGTATGG - Intergenic
978529330 4:109698409-109698431 TTTGGGAGTCAGAAGGGGGATGG - Intronic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
978988448 4:115046218-115046240 ATAGGGAGGCAGAATGGGGCAGG - Intronic
978994061 4:115128116-115128138 ATGGTGACTCAGAAGGGTTAGGG - Intergenic
979188666 4:117831763-117831785 ATGGGAGGCCAGAAGGGGAATGG + Intergenic
979281463 4:118872827-118872849 ATGGAGACTCAAAAGGGGGAGGG - Intronic
979537180 4:121836349-121836371 ATGAGGAGGCATAAGTGGGATGG - Intronic
979728403 4:123992247-123992269 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
979851180 4:125573117-125573139 AAGGGGAGGAAAAAGGGGGAAGG - Intergenic
980097039 4:128501894-128501916 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
980603134 4:135052251-135052273 TTTGGGAGGCAGAAGGGGGACGG - Intergenic
981010734 4:139922277-139922299 AAGGTGAGTGAGAAGGTGGAGGG - Intronic
981178718 4:141714214-141714236 ATGCTGAGTTATAAGGGGGATGG - Intronic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981362769 4:143866549-143866571 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
981372326 4:143973046-143973068 TTGGAGACTCAGAAGCGGGAGGG - Intergenic
981382603 4:144090620-144090642 ATGGAGAGTTGGAAAGGGGATGG - Intergenic
981423800 4:144581083-144581105 ATGGGGAGCCAAAAGGGGGATGG - Intergenic
981592247 4:146376602-146376624 ATGGGGAGCTGGAAAGGGGATGG - Intronic
981815859 4:148829867-148829889 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
982287282 4:153748426-153748448 GTGGGGGGTGAAAAGGGGGAGGG - Intronic
982325809 4:154127277-154127299 GTGGGGAGCTAGAAAGGGGATGG + Intergenic
982504175 4:156197018-156197040 ATGGGGAGCCAGAAGAAGCATGG - Intergenic
982504431 4:156198903-156198925 TGGGGCAGTCAGAAGGGAGATGG - Intergenic
982765029 4:159336328-159336350 TTGGAGACTCAGAAGGGGAAGGG - Intronic
982781913 4:159500177-159500199 ATGGGCAGTGGGAACGGGGAGGG + Intergenic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
982918461 4:161244615-161244637 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
983070094 4:163257401-163257423 ATGGGGAGTTGGAAAGGGGTTGG + Intergenic
983162755 4:164437469-164437491 ATTGGGAGCAAGTAGGGGGAAGG - Intergenic
983400527 4:167259000-167259022 CTGGAGACTTAGAAGGGGGAGGG + Intergenic
983781428 4:171674671-171674693 ATGTGGAGCCGGAAGGGGGCTGG - Intergenic
984245934 4:177275333-177275355 AAGGGGAGCTGGAAGGGGGATGG - Intergenic
984271896 4:177557716-177557738 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
984477415 4:180254900-180254922 ATGAGGAGTCAGGGGCGGGAAGG - Intergenic
984520533 4:180796374-180796396 ATGGGTAACTAGAAGGGGGATGG + Intergenic
985116431 4:186596588-186596610 AAGGGGAGTTTGAAGGGGGTGGG + Exonic
985228143 4:187784675-187784697 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
985271299 4:188197118-188197140 GTGGGGAGTGAGAAGGGGATGGG - Intergenic
985293181 4:188407019-188407041 ATGGGGAGCTGGAAGGTGGATGG - Intergenic
985767174 5:1786211-1786233 CTGGGGGGTCAGATGGGGCAGGG - Intergenic
985854852 5:2416794-2416816 ATAGGGAACCAGAAGGGGGATGG - Intergenic
986165274 5:5267444-5267466 ATGGGGAGCCAGAAAGGGGATGG + Intronic
986230964 5:5864561-5864583 ATGGGGAGCTGGAAGGTGGAGGG + Intergenic
986435845 5:7730038-7730060 ATGGAGACTCCAAAGGGGGAAGG - Intronic
986484018 5:8217288-8217310 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
987005705 5:13707253-13707275 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987212137 5:15693838-15693860 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987251755 5:16107906-16107928 ATGGGGAGCTGGAAGGGGGATGG - Intronic
987262436 5:16216775-16216797 ATGCTGAGTGATAAGGGGGAGGG - Intergenic
987268280 5:16278685-16278707 ATGGGGAATGGGAAAGGGGATGG - Intergenic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
987504836 5:18754368-18754390 ATGGGGAGCTGGAAGTGGGATGG + Intergenic
987715057 5:21557734-21557756 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
987764022 5:22201952-22201974 GTGGGAAGTCAGAAGTGGGAAGG + Intronic
988038103 5:25853472-25853494 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988267230 5:28967709-28967731 TTGGGGAGCCAGAGGGGAGATGG - Intergenic
988457621 5:31400641-31400663 ATGGGGAGCAGGAAGGAGGAGGG - Exonic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
988929914 5:36027805-36027827 ATGGGGAGTCAGGAATGTGAGGG - Intergenic
989128791 5:38083480-38083502 TTGTGGAGTCAGATGTGGGAAGG - Intergenic
989443432 5:41500411-41500433 ATGGATACTCAGAAGGGTGAGGG + Intronic
989719123 5:44504014-44504036 TTGGGGAGCTGGAAGGGGGATGG - Intergenic
990128405 5:52548322-52548344 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
990352642 5:54934275-54934297 ATGGGGTGGCAGCAGGGGGAAGG + Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
990585541 5:57207714-57207736 ATGGGAAGCCAGGAGGGAGATGG + Intronic
990589746 5:57249961-57249983 AGGGGGAGGGGGAAGGGGGAAGG - Intronic
990698236 5:58446574-58446596 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
990792351 5:59496099-59496121 TGGGGGAGCCAGAAGGGAGATGG + Intronic
991207450 5:64065892-64065914 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
991297055 5:65092862-65092884 TTGGGGTGGCAGATGGGGGAGGG - Intergenic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
991425725 5:66489736-66489758 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
991634391 5:68689826-68689848 TTGGGGAGTCAGAGTTGGGAGGG - Intergenic
991648046 5:68821115-68821137 ATGAGGAGGCAAAAGGGTGAAGG - Intergenic
991955717 5:71994469-71994491 ATGGGGAGTGGGAAGGAGGTAGG - Intergenic
992093648 5:73340611-73340633 TGGGGGAGGCAGAAGGGGGATGG - Intergenic
992159845 5:73990646-73990668 GAGGGGAGTCAGCAGGGAGAAGG - Intergenic
992186569 5:74250251-74250273 ATGGGGAGACACAAGGGTGCTGG + Intergenic
992232566 5:74677857-74677879 GTGGAGACTCAGAAAGGGGAGGG - Intronic
992637122 5:78735748-78735770 ATGGGGAGCTAAAAGGGGGATGG - Intronic
992672752 5:79076138-79076160 ATGGGGAGCCAGAAGGGGGATGG + Intronic
992756181 5:79908289-79908311 ATGGGGTGGAGGAAGGGGGAAGG + Intergenic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
992992494 5:82298432-82298454 ATGGGGAGCTGGAAGGGTGATGG + Intronic
993188104 5:84645940-84645962 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
993465260 5:88237492-88237514 ATGGGGAATCAGAAAGGGATTGG - Intronic
993492474 5:88568931-88568953 GTGGGTCGGCAGAAGGGGGAGGG + Intergenic
993540051 5:89138136-89138158 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
994228350 5:97281788-97281810 ATGGAGACTCAGATGGGGGCAGG - Intergenic
994301918 5:98157476-98157498 TGGGGGAGTCAGAGGGGAGATGG + Intergenic
994819290 5:104628132-104628154 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
994999029 5:107103482-107103504 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
995494484 5:112726336-112726358 ATGGGGAGCTGGAAGGGGGATGG + Intronic
995533644 5:113114787-113114809 AAGGGGAGCTAGAAGGGGGATGG - Intronic
996019068 5:118572424-118572446 ATGGGGAGTGAGTAGGGAAAGGG - Intergenic
996215056 5:120856195-120856217 TAGGGAAGCCAGAAGGGGGATGG - Intergenic
996486598 5:124042268-124042290 CTGGGGAGCCAGAAGGGAGATGG - Intergenic
996576729 5:124983967-124983989 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
997716756 5:136048363-136048385 ATGGAGGGTCAGAAGAGGGAAGG - Intronic
998680068 5:144457344-144457366 ATGGGAGGTCAGAAGGGTGGTGG + Intronic
998771589 5:145551948-145551970 ATGGGGAGACAGAAGGCGGGAGG - Intronic
998791162 5:145767323-145767345 ATGGGGAGCTGGAAAGGGGATGG - Intronic
998861404 5:146447536-146447558 ATGGGGTTTAAGAAGGGGGAAGG + Intronic
998868521 5:146529853-146529875 ATGGGGAACTGGAAGGGGGATGG - Intergenic
999037853 5:148373609-148373631 ATAGGGACTGAGAATGGGGAGGG - Intergenic
999250791 5:150181111-150181133 AGGTGCAGTGAGAAGGGGGACGG - Intronic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
999537004 5:152528682-152528704 ATAAGGAGCCAGAAGGGGGATGG + Intergenic
999668495 5:153937322-153937344 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
999782270 5:154858827-154858849 ATTGGGGGTCTGTAGGGGGAAGG + Intronic
1000234449 5:159344555-159344577 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
1000275590 5:159732156-159732178 ATGGGGAGTGAGAGGGGTGCTGG - Intergenic
1000470202 5:161631079-161631101 ATGGGGGGCCAGAAGGGGGATGG + Intronic
1000491413 5:161918864-161918886 ATGGGGACTCCAGAGGGGGAAGG + Intergenic
1000516443 5:162241228-162241250 ATGGGGAGCCAGAAGCCGGATGG + Intergenic
1000658892 5:163915412-163915434 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1000742511 5:164987230-164987252 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1000867956 5:166538429-166538451 ATGGGGAGTTGGAAGGGGGATGG - Intergenic
1000949424 5:167462566-167462588 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1001181151 5:169521886-169521908 TAGGGGAGCCAGAAGGGAGATGG - Intergenic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001523544 5:172412886-172412908 TTGGGGAGTAGGAAGGGAGAAGG + Intronic
1001619564 5:173071945-173071967 CTTGGGAGGCAGAAGTGGGAGGG + Intronic
1001732652 5:173971908-173971930 GTGTGGAGGCAGCAGGGGGAGGG + Intergenic
1001737797 5:174021047-174021069 AAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1001786573 5:174418842-174418864 AGGGGGAGAGGGAAGGGGGAGGG + Intergenic
1001940118 5:175734337-175734359 TGGGGGAGACAGAAGGGAGATGG - Intergenic
1002132862 5:177092100-177092122 ATGGGGAGCCAGGTGGTGGAGGG + Intronic
1002271346 5:178074533-178074555 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1002475712 5:179464583-179464605 ATGGGGAGCCAGAAGGGGAATGG + Intergenic
1002762648 6:214046-214068 ATGGGGAGCTGGAAGGAGGAGGG - Intergenic
1002795669 6:469425-469447 AGGGGGAGAGAGGAGGGGGACGG - Intergenic
1002842772 6:920794-920816 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1003194015 6:3899011-3899033 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1003277534 6:4665221-4665243 ATGGTGAGTAGAAAGGGGGAAGG - Intergenic
1003280037 6:4683212-4683234 ATGGGGCTTCAGAAGGGGTTTGG + Intergenic
1003485796 6:6578049-6578071 TTTGGGAGGCAGAAGTGGGAGGG + Intergenic
1003499783 6:6694838-6694860 TGGGGGAGCCAGAAGGGAGACGG + Intergenic
1003533388 6:6955960-6955982 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1003543813 6:7041464-7041486 TTGGGGAGTCTGAAGAGAGAAGG + Intergenic
1003765793 6:9234958-9234980 ATTGGGAGGCAAAAGAGGGAGGG + Intergenic
1003890069 6:10556143-10556165 ACGGGGAGGCAGAGGGAGGAGGG + Intronic
1004027307 6:11831705-11831727 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1004170671 6:13293323-13293345 TTGGGGACTCAGAAGGGGGAGGG + Intronic
1004469548 6:15917008-15917030 ATCGGGAGCTGGAAGGGGGATGG + Intergenic
1004647204 6:17573913-17573935 ATGGGGAGCTAGAAAGGGAATGG + Intergenic
1004953621 6:20702502-20702524 TGGGGGAGCCAGAAGGGAGATGG + Intronic
1004984079 6:21059917-21059939 GTGAAGACTCAGAAGGGGGAGGG - Intronic
1005029293 6:21494043-21494065 ATGGGGAGCCAGAAGGGGTGTGG - Intergenic
1005492971 6:26363719-26363741 TTGGGGAGGGGGAAGGGGGAGGG + Intergenic
1006180633 6:32151643-32151665 AGGGGGAGACAGAAAGAGGAGGG + Intronic
1006208931 6:32376045-32376067 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1006299506 6:33186117-33186139 AAGGGGAGGTAGTAGGGGGAAGG - Intronic
1006385564 6:33728887-33728909 AAGGGCAGACAGACGGGGGAGGG - Intronic
1006450477 6:34103121-34103143 ATGGGGAGACAGAGGTGGCATGG - Intronic
1006988757 6:38194844-38194866 ATGGGGAGGCAGGAGAGGCAGGG + Intronic
1007186053 6:39973123-39973145 ACAGTGAGTCAGATGGGGGAAGG - Intergenic
1007393285 6:41562805-41562827 ATGGGGAGACAGGAGGGAGGGGG - Intronic
1007415600 6:41689494-41689516 ATGGGGCTTCAGAGGGGAGAAGG - Intronic
1008420322 6:51291701-51291723 ATGTGGAGACAGGAGGGGGATGG + Intergenic
1008439246 6:51513876-51513898 CTGGGGAGTCAGTAGGGTGGGGG + Intergenic
1008730865 6:54481193-54481215 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1008996929 6:57669697-57669719 ATTGGGAGGCAGAAGAAGGAGGG + Intergenic
1009001666 6:57724310-57724332 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
1009271374 6:61619262-61619284 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1009566549 6:65318242-65318264 AAGAGGAGTGAGAAGGGGAAAGG - Intronic
1009698485 6:67142583-67142605 ATGGGGAACTAGAAAGGGGATGG - Intergenic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010494222 6:76513818-76513840 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1011261696 6:85476696-85476718 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1011639594 6:89406587-89406609 TAGGGGAGCCAGAAGGGAGACGG - Intronic
1011771285 6:90676225-90676247 TTGGGGAGGGAGAAGGAGGATGG + Intergenic
1012012989 6:93815233-93815255 ATAGGGACTCAGAAGGGTGGGGG + Intergenic
1012042978 6:94234048-94234070 ATGGGGAGCAGGAAGGGGGATGG - Intergenic
1012319046 6:97819806-97819828 AAGGGGAGGCAGAACAGGGAAGG - Intergenic
1012440198 6:99255180-99255202 TGGGGGAGGCAGAAGGGAGACGG - Intergenic
1012635224 6:101529772-101529794 ATGGGAATTCAGAAGAAGGATGG + Intronic
1012826799 6:104156430-104156452 GTGGGGAGTAGGGAGGGGGAGGG - Intergenic
1012902344 6:105020708-105020730 ATAGAGACTCAGAAGGGTGAGGG - Intronic
1012915447 6:105165512-105165534 ATAGAGAGTGAGAAGGGAGAAGG - Intronic
1012945458 6:105461162-105461184 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1013265487 6:108493401-108493423 AGGGGCAGTCAGAAGGCAGAGGG - Intronic
1013476109 6:110508791-110508813 ATGGGGAGCTAGAAGGGAGATGG - Intergenic
1013562946 6:111324696-111324718 AGGGGGAGGCGGAAGAGGGAAGG + Intronic
1013826063 6:114213095-114213117 ATGGAGAGCTAGAAAGGGGATGG + Intronic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014206815 6:118665125-118665147 GTGGGGAGTAAGAGGAGGGACGG + Intronic
1014332326 6:120085504-120085526 ATGGGGAGGGGGCAGGGGGAAGG - Intergenic
1014393648 6:120896133-120896155 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1014635628 6:123843317-123843339 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1014684315 6:124477345-124477367 ATTGGGAGGGAGAAGGGAGATGG + Intronic
1014778127 6:125533788-125533810 TTGGGGAGGCAGAAAGGGGCAGG + Intergenic
1015042867 6:128742809-128742831 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1015113392 6:129619346-129619368 AGGGGGAGGGAAAAGGGGGAGGG + Intronic
1015113398 6:129619359-129619381 AGGGGGAGGGAAAAGGGGGAGGG + Intronic
1015287075 6:131497862-131497884 TTGGGGAGTAAGAAGGGTGGTGG + Intergenic
1015288549 6:131511435-131511457 ATGGGGAGCTAGAAAGGGGATGG - Intergenic
1015349006 6:132195033-132195055 ACGGGGAGCTGGAAGGGGGATGG + Intergenic
1015553005 6:134431619-134431641 ATAGGGAGTAAGAAGGAGGACGG + Intergenic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1015729616 6:136334745-136334767 TTGGGAAGCCAGAAGGGAGATGG - Intergenic
1015973164 6:138762956-138762978 CTGGGGGGTCAGGAGGGGCAAGG - Intronic
1016155914 6:140808564-140808586 ATGGGAAGCTGGAAGGGGGATGG + Intergenic
1016385971 6:143531243-143531265 TTGGAGACTCAGAAAGGGGAGGG + Intergenic
1016532797 6:145076540-145076562 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1016989389 6:149918843-149918865 AAGAGGAGTCAGGAGGGAGAAGG + Intronic
1016998637 6:149979249-149979271 AAGAGGAGTCAGGAGGGAGAAGG - Intergenic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017506684 6:155074929-155074951 CTGGGGAGTCAGAGGGTGGAGGG + Intronic
1017633611 6:156422844-156422866 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1017782359 6:157725794-157725816 ATGGGGAGTTGGAAAGGGGATGG - Intronic
1017980135 6:159394173-159394195 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1018201437 6:161399168-161399190 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1018320222 6:162600752-162600774 AGGAAGAGTGAGAAGGGGGAGGG - Intronic
1018748388 6:166780358-166780380 ATGGGGAGAGAGATGGGGGAAGG + Intronic
1018953750 6:168394592-168394614 ATGGAGAGAGAGATGGGGGAAGG + Intergenic
1019158193 6:170052779-170052801 AGGGGGAGGCGGAGGGGGGAGGG - Intergenic
1019391927 7:793180-793202 GTGGAGACTCAGAAGGGTGAAGG + Intergenic
1019892729 7:3959572-3959594 ATGGGGACTCACAAGGGTGTGGG - Intronic
1020315256 7:6901206-6901228 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1020966944 7:14882596-14882618 ATAGAGACTCAGAAGGGAGAAGG - Intronic
1021081530 7:16370774-16370796 ATGGGGTGGCAGGTGGGGGAGGG - Intronic
1021083054 7:16386147-16386169 ATGGGGAGCTAAAAGAGGGATGG + Intronic
1021560501 7:21964749-21964771 ATGGAGAGCTGGAAGGGGGATGG - Intergenic
1021820707 7:24494928-24494950 ATGGGGAGCTGGAAGGGGTATGG + Intergenic
1021873132 7:25023194-25023216 TTGGAGACTCTGAAGGGGGAGGG - Intergenic
1022901072 7:34811256-34811278 ATGGGGAACTGGAAGGGGGATGG + Intronic
1022992760 7:35724910-35724932 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1023119956 7:36899163-36899185 AAGTTGAGTCAGATGGGGGATGG + Intronic
1023304958 7:38816243-38816265 ATGGGCTGTGAGATGGGGGAAGG + Intronic
1023829359 7:44029815-44029837 ACGGGGAGGGAGAAGGTGGAAGG - Intergenic
1024203063 7:47126034-47126056 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1024268132 7:47622097-47622119 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1025777360 7:64570516-64570538 AGGGGGAGGGGGAAGGGGGAGGG + Intergenic
1025888540 7:65622548-65622570 ATGGGGAGTCAGCAGGACAAAGG + Intergenic
1026111066 7:67459302-67459324 ATGGGGATCCAGAAGGGGGATGG + Intergenic
1026248407 7:68644917-68644939 ATGGGGAGCTAGAAGGGGGATGG - Intergenic
1026272018 7:68844936-68844958 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1026313925 7:69211683-69211705 ATGGGGAGCCAGAAGGAGGGTGG - Intergenic
1026557782 7:71422892-71422914 ATGGGGAGCAGGAAGGGGGATGG + Intronic
1026741560 7:72981865-72981887 AAGGGGAGGGAGAAGGGGCAGGG + Intergenic
1026801394 7:73402249-73402271 AAGGGGAGGGAGAAGGGGCAGGG + Intergenic
1027102175 7:75383213-75383235 AAGGGGAGGGAGAAGGGGCAGGG - Intergenic
1027182457 7:75950404-75950426 TTGGGGAGTTAGAAGGGAGGAGG + Intronic
1027397147 7:77767780-77767802 AGGGGGAGGGAGAAGGGGGAGGG - Intronic
1027408103 7:77884388-77884410 ATGGAGACTCAGAAGGGGTAGGG - Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1027706143 7:81535912-81535934 ATGGGGAGCAGGAAAGGGGATGG - Intergenic
1027708518 7:81567163-81567185 ATGGGGAGCGGGAAAGGGGATGG - Intergenic
1027888314 7:83937807-83937829 ATGGGGAGTTGGGAGGGGAATGG - Intergenic
1027932281 7:84552779-84552801 TCCGGGAGCCAGAAGGGGGATGG - Intergenic
1027936769 7:84615592-84615614 ATGGGAAATCACAAGGAGGAAGG + Intergenic
1028123910 7:87089354-87089376 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1028427536 7:90706968-90706990 ATGGGGAGGCAGGACAGGGAGGG - Intronic
1028872287 7:95782799-95782821 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1029017277 7:97327507-97327529 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1029412873 7:100426927-100426949 AAGGGGAGGGAGGAGGGGGAGGG - Intronic
1029541428 7:101184833-101184855 ATGGGGTGTGATAAGGGGGATGG - Intergenic
1029611601 7:101629567-101629589 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1029739665 7:102484073-102484095 ACGGGGAGGGAGAAGGTGGAAGG - Intronic
1029757666 7:102583252-102583274 ACGGGGAGGGAGAAGGTGGAAGG - Intronic
1029775602 7:102682313-102682335 ACGGGGAGGGAGAAGGTGGAAGG - Intergenic
1029910215 7:104137765-104137787 TTGGGGAGCCCGAAGGAGGATGG - Intronic
1029928469 7:104344418-104344440 TTGGAGATTCAGAAGGGGAAGGG - Intronic
1029945625 7:104529739-104529761 ATGGTGAGTCAGAACAGGGATGG + Intronic
1030021424 7:105278747-105278769 AGGGGAAGGCAGAAGGCGGAAGG + Intronic
1030132896 7:106218307-106218329 ATGGGGAGTGAGAAGGTGTCTGG + Intergenic
1030387166 7:108878209-108878231 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1030794414 7:113770292-113770314 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1030991544 7:116307143-116307165 ATGGAGACTTAGAAGGGTGATGG + Intronic
1031003674 7:116447250-116447272 TTGGAGACTCAGAAGAGGGAGGG + Intronic
1031232308 7:119123647-119123669 ATGGGGAGCCAGCAGGGGGATGG - Intergenic
1031651652 7:124298848-124298870 ATGGGGGGTGAGAGGGAGGAGGG - Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1031765640 7:125773358-125773380 ATAGGGAGCCAGCAGGGGGATGG - Intergenic
1031853903 7:126899414-126899436 ATGGGGAGTCAGCAGGACAAAGG - Intronic
1031871271 7:127091774-127091796 GTGGGGAGTCATCAGTGGGACGG - Intronic
1032544993 7:132734370-132734392 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1032943685 7:136825226-136825248 ATGCGGCGGCAGAAGGGAGATGG + Intergenic
1033767093 7:144505844-144505866 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1033881302 7:145887155-145887177 ATGGTGAGCTAGAAAGGGGATGG + Intergenic
1033970620 7:147034691-147034713 TGGGGAGGTCAGAAGGGGGATGG + Intronic
1034099272 7:148437308-148437330 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1034263825 7:149772306-149772328 CTGGGGAGACAGAGGGGGAAGGG - Intronic
1034424916 7:151009351-151009373 ATGGGGAGTCAGAGAGGGGTGGG - Intronic
1034931301 7:155166005-155166027 CTGGGGAGCCAGAAGGGGGATGG - Intergenic
1035023734 7:155813665-155813687 ATGGCGATTGAGAAGGGGAAGGG - Intergenic
1035111228 7:156483713-156483735 AGGGGGAGACAGGAGGGGGAGGG + Intergenic
1035138666 7:156734479-156734501 ATGGAGAGTCAGAAGGGAGAGGG + Intronic
1035343219 7:158178354-158178376 TTGGAGACTCAGAAGCGGGAGGG - Intronic
1035543755 8:462732-462754 TTGGAGACTCAGAAGAGGGAAGG + Intronic
1035574577 8:696546-696568 ATGGGGAGGAAGGAGAGGGAGGG - Intronic
1035574655 8:696894-696916 ATGGGGAGGAAGGAGAGGGAGGG - Intronic
1035822202 8:2605552-2605574 ATGTGGGGTCAGCAGTGGGAGGG - Intergenic
1035824397 8:2629083-2629105 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1036101859 8:5795690-5795712 ATGGGGAGAGAGAAGGGGGATGG - Intergenic
1036191855 8:6678183-6678205 ATGGGGAGAGAGGTGGGGGAAGG - Intergenic
1036405458 8:8450896-8450918 ATGGGAGATGAGAAGGGGGAGGG + Intergenic
1036463493 8:8974735-8974757 TTGGGGAGGGTGAAGGGGGAGGG - Intergenic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036854201 8:12228398-12228420 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1036994813 8:13643314-13643336 ATGAGGAGTCAGGTGGGAGACGG + Intergenic
1037175889 8:15945438-15945460 ATGGGGAGCTAGAAGGGGGATGG - Intergenic
1037226783 8:16602235-16602257 ATCGGGAGCCAGGAGGGGGATGG - Intergenic
1037502267 8:19497424-19497446 ATGAGTAGTCAGGAGGGGGCTGG - Intronic
1037577185 8:20218518-20218540 AGGAGGATTCAGAAGGGCGATGG - Intronic
1037586869 8:20283016-20283038 CTGGGGGCTCAGAAGTGGGATGG + Intronic
1038067866 8:23982465-23982487 ATGGGGATTCAAAAGGGAGTTGG + Intergenic
1038134832 8:24773884-24773906 AAGGGGAGGGAGAAAGGGGAGGG + Intergenic
1038301173 8:26350506-26350528 CTGGGGAGGCTGAAGTGGGAAGG - Intronic
1038314039 8:26467526-26467548 AGGGTGGGTCAGGAGGGGGAGGG - Intronic
1038401341 8:27287096-27287118 ACGGTGGGTCAGAAGGCGGAAGG - Exonic
1038570467 8:28657918-28657940 ATGGGAAGGCAGAAAGAGGAAGG - Intronic
1038769873 8:30467482-30467504 ATGGTCTGTCAGAAGAGGGATGG + Intronic
1038780152 8:30563179-30563201 AGGGGGGGTCAGAAGGGGACAGG + Intronic
1038862381 8:31401625-31401647 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1039035148 8:33351430-33351452 ATGGGGAGTCGGCGGGGGGCAGG + Intergenic
1039086315 8:33783604-33783626 TGGGGGAGCCAGAAGGGGGATGG + Intergenic
1039098347 8:33911922-33911944 ATGAAGACTCAGAAGGGTGAGGG + Intergenic
1039290443 8:36088867-36088889 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
1039291082 8:36095126-36095148 AGGGGGACTCAGGAGGAGGAAGG + Intergenic
1039514544 8:38120956-38120978 ATGGGTAGCCATGAGGGGGAAGG - Exonic
1040602361 8:48897362-48897384 ATGGGGAGCAAGAAGGGGGATGG + Intergenic
1040719859 8:50306051-50306073 TTAGAGACTCAGAAGGGGGAGGG - Intronic
1041312353 8:56529762-56529784 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1041648489 8:60277885-60277907 AAGGGGAATCTGAAGGAGGAAGG + Intronic
1041918302 8:63157864-63157886 ATGGGGAGTCAGAAAGGGGATGG + Intergenic
1041934719 8:63322440-63322462 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1042159217 8:65875106-65875128 ATGGGGATCCAGAAGCAGGATGG + Intergenic
1042179067 8:66066709-66066731 TCGGAGACTCAGAAGGGGGAGGG + Intronic
1042224375 8:66504125-66504147 GTGGGGAGGGAGAATGGGGAGGG - Intronic
1042316834 8:67434865-67434887 TTGGGGGGTCAGGAGGGGTAAGG - Intronic
1042566011 8:70112772-70112794 ATGGGGAATGAGAGAGGGGAAGG + Exonic
1042598198 8:70471749-70471771 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1042984371 8:74566688-74566710 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1043074665 8:75683186-75683208 TTGGAGAGTCAGAAGCGGGGAGG - Intergenic
1043238457 8:77899699-77899721 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1043367596 8:79553275-79553297 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1043499205 8:80836438-80836460 ATGGGGAATGAGGAGGGAGAGGG - Intronic
1043599806 8:81923583-81923605 ATGAGGAGCCCCAAGGGGGATGG - Intergenic
1043815108 8:84792279-84792301 ATGGGGAGATGGAAGGGGGATGG + Intronic
1043999786 8:86865442-86865464 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1044085340 8:87936428-87936450 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1044206203 8:89494331-89494353 ACGGGGAGCCAGAAGGGAGATGG - Intergenic
1045355920 8:101388996-101389018 ATGGGGACAGAGAAGGAGGATGG - Intergenic
1045861522 8:106819235-106819257 TGGGGGAGCCAGAAGGGAGACGG - Intergenic
1045938499 8:107710982-107711004 TGGGGGAGTCAGAAGGGAGATGG + Intergenic
1045942513 8:107755420-107755442 ATGGGAAGCCAGAAGGGAGATGG - Intergenic
1046174683 8:110560050-110560072 ATGGGGAGCCAGAAGGTGGAGGG + Intergenic
1046232951 8:111381475-111381497 TTGGAGACTCAGAAGGGGGCAGG - Intergenic
1046277442 8:111982237-111982259 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1046582522 8:116110870-116110892 ATGGGGAGCTAGAAAGGGGATGG - Intergenic
1046870163 8:119197120-119197142 TGGGGGAGCCAGAAGGGAGATGG + Intronic
1047113788 8:121818524-121818546 ATGGGGAGCAGGAAAGGGGATGG - Intergenic
1047202103 8:122775977-122775999 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1047203695 8:122786700-122786722 GGGGGGAGGCAGAAGGGGAATGG - Intronic
1047577178 8:126169416-126169438 ATGAGGAGTGAGGAGGAGGAAGG - Intergenic
1047586521 8:126279690-126279712 ATGGGGAGCCAGAAGGGAGATGG - Intergenic
1047727719 8:127698620-127698642 ATGGGAACTTAGAAGGGAGAGGG - Intergenic
1047883156 8:129218586-129218608 ATGGGGAGCCAAAAGGGGAATGG - Intergenic
1048123507 8:131607786-131607808 ACAGGGAGCCAGAAGGGGAATGG + Intergenic
1048194820 8:132323622-132323644 ATGGGAAGTCAGAGAGAGGATGG - Intronic
1048648699 8:136450945-136450967 ATGGGGAGTTGGAAGGGGGATGG + Intergenic
1048900364 8:139031737-139031759 ATGGGGAGCTGGAAAGGGGAAGG + Intergenic
1049083131 8:140457910-140457932 ATGGGGAGGGAGGAGGAGGAGGG + Intronic
1049269658 8:141687563-141687585 ATGAGGAGGCAGGAGGGGCAGGG + Intergenic
1049451542 8:142664706-142664728 GAAGGGAGGCAGAAGGGGGACGG - Exonic
1049978858 9:885408-885430 TAGGGGAGTCAGAAAGGAGATGG + Intronic
1050043620 9:1521102-1521124 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1050479300 9:6073393-6073415 TCGGGGAGTCAGAAGGGAGACGG - Intergenic
1050501959 9:6307918-6307940 AGGGGAAGTCAAGAGGGGGAGGG + Intergenic
1050569984 9:6927805-6927827 ATGGGAAGTGGGAAGGGGCAAGG - Intronic
1050772807 9:9224308-9224330 ATGGGGAGGGAGAAAGGGAAAGG + Intronic
1050829109 9:9989531-9989553 AAGGGGAGCTAGAAGGGGGATGG - Intronic
1051263471 9:15288534-15288556 ATGGGGAGCTGGAAGGGGGATGG - Intronic
1051549744 9:18315427-18315449 AGGGGGAGTGAGGAGGGGGGTGG + Intergenic
1051735884 9:20198690-20198712 TTGGGGAGAGAGAAGGGGGTGGG - Intergenic
1051887167 9:21905266-21905288 GTGGTGAGCCAGAAGGGGAATGG + Intronic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1052736231 9:32345252-32345274 ATGGGGTTTGAGAAGGAGGAGGG - Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1052778402 9:32755813-32755835 GCGGGGAGCCAGAAGGGAGATGG + Intergenic
1052793653 9:32902287-32902309 GTGGGGAGCTAGAAGGGGGATGG - Intergenic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053124904 9:35573014-35573036 ATGGAGAGACAGAAAGGGGGAGG + Intergenic
1053221269 9:36315312-36315334 GTGGGGGGTCAGAAGTGTGAGGG + Intergenic
1053357071 9:37455321-37455343 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1053361023 9:37486592-37486614 AGGGAGTGTCAGAATGGGGATGG - Intronic
1053428714 9:38027835-38027857 CTGGGGAGGCAGAAGGGACAGGG + Intronic
1053437303 9:38084554-38084576 ATGGGGATTAGGAAGGAGGAAGG + Intergenic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053524852 9:38818032-38818054 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1053525064 9:38820818-38820840 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1053525511 9:38826230-38826252 GAGGGGAGCCAGAGGGGGGATGG - Intergenic
1053750139 9:41245072-41245094 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1054197086 9:62042448-62042470 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1054197295 9:62045240-62045262 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1054197740 9:62050657-62050679 GAGGGGAGCCAGAGGGGGGATGG - Intergenic
1054255638 9:62809411-62809433 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1054335673 9:63806196-63806218 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1054353444 9:64040613-64040635 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1054640614 9:67537715-67537737 GAGGGGAGCCAGAGGGGGGATGG + Intergenic
1054641114 9:67543442-67543464 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1054641322 9:67546246-67546268 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055340091 9:75272403-75272425 TTGGAAACTCAGAAGGGGGAAGG - Intergenic
1055356509 9:75443059-75443081 TTGGGGAGCCAGAAAGGAGATGG + Intergenic
1055734460 9:79312541-79312563 AGATGGAGTCAGAAGGGAGATGG - Intergenic
1055869337 9:80855336-80855358 ATGGGGAGCCGGAAAGGGGATGG + Intergenic
1055931033 9:81560055-81560077 ACAGGGAGTGAGGAGGGGGAGGG + Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056871905 9:90289626-90289648 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1056942122 9:90964789-90964811 AGGGTGAGTCAGTCGGGGGAAGG + Intergenic
1057231547 9:93324535-93324557 ATGGGGAGGCTGGAGGGGGATGG - Intronic
1057236542 9:93366082-93366104 ATGGGGAGGCTGGAGGGGGATGG + Intergenic
1058030011 9:100185707-100185729 TTGGGGACTCAGAAAGGGGAAGG - Intronic
1058093856 9:100836984-100837006 ATGGGCAGCTGGAAGGGGGATGG - Intergenic
1058236598 9:102498123-102498145 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1058276494 9:103048039-103048061 TTAGAGAATCAGAAGGGGGAGGG + Intergenic
1058311933 9:103514845-103514867 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1059042603 9:110830565-110830587 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1059476427 9:114551500-114551522 CTTGGGAGGCTGAAGGGGGAGGG - Intergenic
1059949275 9:119445215-119445237 AGGGGGAGGGGGAAGGGGGAGGG - Intergenic
1059952226 9:119477705-119477727 ATGCGGAGCCAGAAGGGGGATGG + Intergenic
1060045429 9:120336711-120336733 GTGGGGAGTCAGAAAGATGAGGG + Intergenic
1060791693 9:126489656-126489678 ATGGGGAGCCAGCAGGGTGACGG - Intronic
1061074805 9:128334607-128334629 ATGGGGACTCAGAGAGGGGAAGG - Intergenic
1061109199 9:128555335-128555357 ATGTGGAGTCTAAAGAGGGAGGG - Intronic
1061246048 9:129401748-129401770 AGGGGGAGGGAGAAGGGGGGAGG - Intergenic
1061500355 9:130998198-130998220 ATGGGGAGCCCAAAGGGGGAAGG - Intergenic
1061637473 9:131922022-131922044 ATGGGGAGGGGGGAGGGGGAGGG + Intronic
1061938529 9:133871878-133871900 CTGGGGGCTCAGAAGGGGCAGGG - Intronic
1062374114 9:136254340-136254362 AGGGGGTGTCAGAAGCGGCATGG - Intergenic
1203695907 Un_GL000214v1:96717-96739 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1203741777 Un_GL000218v1:9723-9745 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1203371924 Un_KI270442v1:315169-315191 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1203701966 Un_KI270742v1:4313-4335 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1203640366 Un_KI270751v1:7346-7368 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1185459839 X:328886-328908 AGGGGGAGAGAGGAGGGGGAGGG - Intergenic
1185769787 X:2757073-2757095 TTGGGGAGTTGGAAAGGGGATGG + Intronic
1185796716 X:2971851-2971873 ATGGGGAGTTGGAAAGGGGACGG + Intergenic
1185803289 X:3032598-3032620 AGGGAGAGACAGAAGAGGGAGGG + Intronic
1185837749 X:3360948-3360970 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1185926441 X:4152321-4152343 TTGGACACTCAGAAGGGGGAGGG - Intergenic
1186036474 X:5428882-5428904 ATGGGGAGCCGGAAAGGGGATGG + Intergenic
1186286230 X:8046718-8046740 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
1186835861 X:13437159-13437181 TTGGAGACTCAGAAGGGTGAGGG + Intergenic
1186966617 X:14793837-14793859 GTCAGGAGTCAGAAGGGGCATGG + Intergenic
1187097280 X:16161906-16161928 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187138524 X:16571154-16571176 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187465198 X:19520752-19520774 ATGGGGGTTGAGAAGGGTGATGG - Intergenic
1187586657 X:20669993-20670015 TTGGATACTCAGAAGGGGGAAGG - Intergenic
1187943404 X:24403119-24403141 ATGGGGAGGGGGCAGGGGGAGGG - Intergenic
1188080948 X:25839805-25839827 ATGGGAGGTCAGGAGGGGTAGGG + Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188437561 X:30179662-30179684 ATGGGGAGCTTGAAAGGGGATGG - Intergenic
1188699771 X:33243870-33243892 ATGGGGAATCAGAAGGGTGGAGG + Intronic
1188807101 X:34605066-34605088 ATGGGGAGCTGGAAGTGGGATGG - Intergenic
1189494377 X:41495827-41495849 ATGGAAATTCAGAAGGGTGAGGG - Intergenic
1189837332 X:45039210-45039232 ATGGGGAGGCAGAGGGGGGATGG - Intronic
1190056340 X:47183215-47183237 ATGGAGACTCAAAAGGTGGAGGG + Intronic
1190553362 X:51608473-51608495 ATGGTGAGTCTGAAAGGAGAAGG - Intergenic
1190600822 X:52089973-52089995 ATGGGGAGCCAAAAGGGGAATGG - Intergenic
1190619076 X:52266989-52267011 AAGGGGAGCCAGAGGGAGGAAGG + Intergenic
1190631293 X:52389432-52389454 ATGGGGAGCTAGAAGGTGGAGGG + Intergenic
1190637099 X:52446146-52446168 AAGGGGAGCCAGAGGGAGGAAGG - Intergenic
1191052963 X:56213969-56213991 AAGGGGAGCTAGAAAGGGGATGG + Intergenic
1191146047 X:57166185-57166207 ATGGAAAGCCAGAGGGGGGATGG - Intergenic
1191673177 X:63768135-63768157 TTGGAGACTCAGAAGGGGAAGGG - Intronic
1191767117 X:64710013-64710035 AAGGGGAGCTGGAAGGGGGATGG + Intergenic
1191974902 X:66861309-66861331 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1191999716 X:67136456-67136478 GTGGGGTGTGGGAAGGGGGAGGG - Intergenic
1192058408 X:67797531-67797553 TTGGAGACTAAGAAGGGGGAGGG + Intergenic
1192089723 X:68140920-68140942 ATGGGGAATTGGAAAGGGGATGG - Intronic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192390400 X:70720368-70720390 ATGGGGTGGGAGAAGGGGGTAGG + Intronic
1193187515 X:78530448-78530470 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1193322032 X:80134062-80134084 ATGGGGAGCTAAAAGGGGAATGG - Intergenic
1193358422 X:80551155-80551177 TCGGGGAGCCAGAAGGGAGATGG + Intergenic
1193416378 X:81229529-81229551 TTGGGGAGCCAGAAGGGAGATGG + Intronic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193656256 X:84201637-84201659 ATGGGAAGGCAGAAGTGGGAGGG - Intergenic
1193702468 X:84779913-84779935 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1194088515 X:89558244-89558266 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1194119463 X:89942998-89943020 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1194145648 X:90258690-90258712 TTGGAGATTCAGGAGGGGGAAGG + Intergenic
1194535672 X:95103551-95103573 TGCGGGAGTCAGAAGGGAGATGG + Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1194763076 X:97816994-97817016 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1195010283 X:100726931-100726953 ATGGAGACTCAGAAGGGTGAGGG - Intronic
1195519482 X:105814561-105814583 ATGGGAAGTCACAAGGAAGAAGG - Intergenic
1195962480 X:110400490-110400512 AGGAGGAGTCAGAAGAGGTAGGG - Intronic
1196203648 X:112914524-112914546 ATGGGGTGGAGGAAGGGGGAGGG - Intergenic
1196242066 X:113353424-113353446 TGGGGGAGCCAGAAGGGGGATGG - Intergenic
1196271419 X:113716342-113716364 ATGGGGAACCGGAAGGGGAATGG - Intergenic
1196395906 X:115261479-115261501 ATGGGGAGTTAAAAAGGGGATGG + Intergenic
1197462094 X:126755318-126755340 AAGGGGAGCTAGAAAGGGGATGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197645952 X:129016681-129016703 TTGGAGACTCAGAAGGGGGTAGG - Intergenic
1197987602 X:132283612-132283634 TTGGCGTCTCAGAAGGGGGAAGG - Intergenic
1198134421 X:133733273-133733295 TTAGGGACTCAGAAGGGGGAGGG + Intronic
1198233104 X:134712263-134712285 CTGGGAAGTCAGATGGGGTATGG - Intronic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198661753 X:138976533-138976555 ATAAAGACTCAGAAGGGGGATGG + Intronic
1198883409 X:141306528-141306550 ATGGGGAGCCAGAAAGGAGATGG - Intergenic
1198964274 X:142210757-142210779 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1199078096 X:143546956-143546978 TTAGAGACTCAGAAGGGGGAAGG + Intergenic
1199110821 X:143931843-143931865 TTGGAGATTCAGAAGGGGAAGGG - Intergenic
1199142628 X:144331436-144331458 CGGGGGAGCCAGAAGGGAGATGG + Intergenic
1199432437 X:147776559-147776581 AAGGGAAGCTAGAAGGGGGATGG + Intergenic
1199794238 X:151179468-151179490 AGGGGGAGGGAGAAGGAGGAGGG - Intronic
1199966786 X:152826817-152826839 GTGGGGAGGCAGAAGGGGTGAGG - Intergenic
1200019775 X:153192840-153192862 AGAGTGAGTCAGGAGGGGGAAGG - Intergenic
1200371714 X:155733017-155733039 GTGGGGAGAGAGAAGGGGAATGG + Intergenic
1200441191 Y:3214291-3214313 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1200472336 Y:3600555-3600577 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1200491400 Y:3827990-3828012 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1200690383 Y:6303074-6303096 ATGGGGACCCACAAGGGAGATGG + Intergenic
1200710125 Y:6475873-6475895 ATGGGGAGCCAGAATGGAGATGG + Intergenic
1200883074 Y:8240962-8240984 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1200910060 Y:8523971-8523993 ATGGGGAGCCAGAAGGAAGATGG - Intergenic
1200940573 Y:8775978-8776000 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1200955187 Y:8937524-8937546 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1200960203 Y:8989482-8989504 ATGGAGAGCCAGAAGGGAGATGG - Intergenic
1200985270 Y:9296841-9296863 ATGGGGAGCTAGAAAGGAGATGG + Intergenic
1201023990 Y:9688835-9688857 ATGGGGAGCCAGAATGGAGATGG - Intergenic
1201044890 Y:9871642-9871664 ATGGGGACCCACAAGGGAGATGG - Intergenic
1201066423 Y:10099957-10099979 ATGGAGACTCAGGAGGGTGAGGG - Intergenic
1201155309 Y:11127177-11127199 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1201339822 Y:12922726-12922748 ATAGGGAGCCAGAAAGGGGATGG + Intergenic
1201340344 Y:12926352-12926374 GTGGGGAGCCAGAAGGGCGATGG + Intergenic
1201634301 Y:16105092-16105114 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1201695339 Y:16818278-16818300 ATGGGGACTTAGAAGGCGGATGG + Intergenic
1201727786 Y:17172570-17172592 TTTGGGAGCCAGAAGGGAGATGG + Intergenic
1201751498 Y:17436650-17436672 ATGGGGAGATGGAAAGGGGATGG + Intergenic
1201761461 Y:17543930-17543952 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1201840091 Y:18362060-18362082 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1202107191 Y:21384020-21384042 ATGGTGAGCCAGAAGGGAGATGG + Intronic
1202111115 Y:21421701-21421723 ATGGGGACCCAGAAGGCAGATGG + Intergenic
1202117356 Y:21482454-21482476 ATGGGGACCCAGAAGGGAAATGG - Intergenic
1202183592 Y:22160047-22160069 ATGGGGAGCCAGAATGGAGATGG + Intergenic
1202200009 Y:22336240-22336262 ATGGGGAGCCAGAAGGGAGATGG - Intronic
1202207767 Y:22426354-22426376 ATGGGGAGCCAGAATGGAGATGG - Intergenic
1202233324 Y:22678768-22678790 ATGGGGAGCCAGAAGGGAGACGG - Intergenic
1202309832 Y:23517390-23517412 ATGGGGAGCCAGAAGGGAGACGG + Intergenic
1202560969 Y:26153203-26153225 ATGGGGAGCCAGAAGGGAGACGG - Intergenic