ID: 956393386

View in Genome Browser
Species Human (GRCh38)
Location 3:68799106-68799128
Sequence GTGAACATCTTGAGGGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 248}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956393386_956393396 19 Left 956393386 3:68799106-68799128 CCCCCCTCCCTCAAGATGTTCAC 0: 1
1: 0
2: 2
3: 27
4: 248
Right 956393396 3:68799148-68799170 TATGAATGTGTTGTCTTACCTGG 0: 1
1: 0
2: 5
3: 33
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956393386 Original CRISPR GTGAACATCTTGAGGGAGGG GGG (reversed) Intronic
901762694 1:11480800-11480822 GGGATCTTCTGGAGGGAGGGAGG + Intronic
902873472 1:19327544-19327566 GTGAACAGATGGAGGGAGGGAGG - Intronic
903397418 1:23012515-23012537 GTGATGATATTCAGGGAGGGAGG - Intronic
904293912 1:29505577-29505599 GGGAACATCTTCAGGGAGAGAGG + Intergenic
906665675 1:47620208-47620230 GTGAGCAACCTGAGGCAGGGTGG + Intergenic
909056398 1:70826047-70826069 GTGAACATTTTGGGGGACGGGGG + Intergenic
910659837 1:89660070-89660092 GTGCTCTTCTTGAGAGAGGGTGG + Intronic
911109685 1:94169420-94169442 GTCAAGAGGTTGAGGGAGGGAGG + Intronic
915936777 1:160094177-160094199 GAGAACAGCTGGAGTGAGGGAGG + Intronic
917466971 1:175288250-175288272 TGGAACAACTGGAGGGAGGGAGG + Intergenic
917517732 1:175722043-175722065 GAGAACACCTGGAGGGAGTGAGG - Intronic
917781821 1:178405355-178405377 GTGGACATCTTGGGAGATGGGGG - Intronic
918471238 1:184876609-184876631 GAGAACCTCTTGAGCCAGGGAGG + Intronic
920301030 1:204989153-204989175 GTTCACCTCTTGAGGGAGGCAGG + Intronic
921901605 1:220457056-220457078 TGGAACATCTTGAAGGAGGGTGG + Intergenic
922415082 1:225414061-225414083 GTGAACCACCAGAGGGAGGGAGG + Intronic
922609131 1:226911425-226911447 TTGAACATAGTGAGGGTGGGTGG + Intronic
922610127 1:226920313-226920335 GGGAACATTTTGGGGGAGTGAGG + Intronic
922685794 1:227638021-227638043 GTTAACATATTGAAGGAGAGTGG + Intronic
923515488 1:234694619-234694641 CTGAACATCAGGAGTGAGGGGGG - Intergenic
923755760 1:236789843-236789865 GGGCACATTGTGAGGGAGGGAGG + Intergenic
923981446 1:239328522-239328544 GTGAAGACCTTGAGGCAGGGAGG - Intergenic
1062914484 10:1236348-1236370 GTGAACACCGGGAGGCAGGGGGG - Intronic
1062914901 10:1237705-1237727 GTGAACACCGGGAGGGAGAGGGG - Intronic
1062915032 10:1238111-1238133 GTAAACACCGGGAGGGAGGGGGG - Intronic
1062915167 10:1238538-1238560 GTGAACACCGGGAGGGAGGGGGG - Intronic
1062915177 10:1238562-1238584 GTGAACACCGGGAGGGAGAGGGG - Intronic
1062915494 10:1239573-1239595 GTAAACACCGGGAGGGAGGGGGG - Intronic
1062915541 10:1239717-1239739 GTGAACACCGGGAGGGAGGGGGG - Intronic
1062915558 10:1239765-1239787 GTAAACACCGGGAGGGAGGGGGG - Intronic
1062915600 10:1239885-1239907 GTGAACACCGGGAGGGAGAGGGG - Intronic
1062915608 10:1239909-1239931 GTGAACACCGGGAGGGAGAGGGG - Intronic
1062915644 10:1240029-1240051 GTAAACACCGGGAGGGAGGGGGG - Intronic
1062915699 10:1240199-1240221 GTAAACACCGGGAGGGAGGGGGG - Intronic
1064262221 10:13795087-13795109 GTGAACATCACCAGGGAGGTGGG + Intronic
1064740383 10:18427372-18427394 TTGAAGATTTTGGGGGAGGGTGG + Intronic
1067800630 10:49356206-49356228 GAGGACATCTTTAGGGAGAGAGG + Intergenic
1068687934 10:59888525-59888547 GTCAACAGCTTTAGGGAGGAAGG + Intronic
1069956062 10:72052677-72052699 GTGAACATTTTCAGGCAGTGGGG + Intergenic
1071711234 10:88051738-88051760 GTGAACAGCATGGGGGTGGGTGG + Intergenic
1071817786 10:89250834-89250856 CTGAAAATCTCGAAGGAGGGGGG + Intronic
1072608387 10:97001579-97001601 CTGAACTGCTGGAGGGAGGGGGG + Intronic
1072862441 10:99020641-99020663 GTGTATGTGTTGAGGGAGGGTGG + Intronic
1073294875 10:102432770-102432792 GTGAAGGTCTTGAGAGGGGGTGG + Intergenic
1075054547 10:119207658-119207680 GGGAGCGTGTTGAGGGAGGGGGG + Exonic
1076046399 10:127297442-127297464 GGGACCATCTTGATGGAGGGAGG + Intronic
1076710904 10:132333610-132333632 GTGAACATCTTTGGAGGGGGTGG - Exonic
1076765033 10:132628434-132628456 GAGCACATCTGGAGGGAGAGGGG - Intronic
1077337226 11:2010832-2010854 GTGCACATGGGGAGGGAGGGAGG - Intergenic
1080055476 11:27902219-27902241 GTGAAGGTCTGGAGAGAGGGAGG + Intergenic
1081967802 11:47180046-47180068 ATGATCATCTGGAGAGAGGGTGG + Intronic
1084645675 11:70456171-70456193 GATACCATCTTGTGGGAGGGGGG + Intergenic
1084905957 11:72347690-72347712 ATGGACATCTTGGGTGAGGGTGG - Intronic
1085303381 11:75471675-75471697 ATGAACACCTTGAGCAAGGGTGG - Intronic
1087870760 11:103290142-103290164 GTGAACCTTTTGAGGGACAGGGG + Intronic
1088343838 11:108800151-108800173 ATGAACATCTTGACCGAGCGCGG + Intronic
1088824633 11:113483427-113483449 GTGAAAGTTTTGATGGAGGGAGG + Intergenic
1088911296 11:114194407-114194429 GTCAAGATCTTGAGGGCAGGGGG - Intronic
1089460567 11:118650675-118650697 GTGTACATTTTCAGGGAAGGAGG - Intronic
1089843358 11:121438443-121438465 GTGAGAATGTAGAGGGAGGGTGG - Intergenic
1090649938 11:128797810-128797832 GTGATCATCTTTAGGAAGAGGGG - Intronic
1202820210 11_KI270721v1_random:66014-66036 GTGCACATGGGGAGGGAGGGAGG - Intergenic
1091642939 12:2251295-2251317 GTGACCATCATGAGGGCAGGCGG + Intronic
1092436920 12:8456046-8456068 GGCAACATCTTTAGGGAGAGAGG + Exonic
1095118787 12:38387859-38387881 ATGGACATCTTGGGGGAAGGTGG - Intergenic
1095403542 12:41842376-41842398 GTGAACATCTTGTTGGGAGGGGG - Intergenic
1096689275 12:53309514-53309536 GGAAACATCTTGGGGGAAGGAGG - Intronic
1098429559 12:70404922-70404944 GTGAACATTTAGAGTGAGGAGGG + Intronic
1100768161 12:97891629-97891651 GAGAATCGCTTGAGGGAGGGAGG + Intergenic
1101532302 12:105584706-105584728 TTGAACACCTGGTGGGAGGGTGG + Intergenic
1101698675 12:107151373-107151395 CAGAACATCTTGAAGCAGGGAGG + Intergenic
1101998497 12:109541912-109541934 GAGATCATCTTGGGTGAGGGTGG - Intergenic
1102980792 12:117239327-117239349 ATGAACCTCTTAAGGGAGGGTGG - Intronic
1104392364 12:128401894-128401916 GTAAACATCTATGGGGAGGGTGG - Intronic
1109683553 13:65784225-65784247 GTCAACATGTTGATGGCGGGAGG - Intergenic
1110647523 13:77905619-77905641 GTGATCATATTGAGTGAGGGTGG + Intronic
1110794855 13:79624332-79624354 GTGAACATCATGGGGCAGGAAGG + Intergenic
1111287389 13:86112680-86112702 GTGGAGATATTGAGGGAGAGAGG - Intergenic
1111564659 13:89999255-89999277 CTCAACATCTTGAGGTGGGGAGG - Intergenic
1112283386 13:98082400-98082422 GTGGCTACCTTGAGGGAGGGTGG + Intergenic
1113504060 13:110800854-110800876 GTGAACACCTTGAAGGAGAGGGG - Intergenic
1114528305 14:23379692-23379714 GGGAACTTATTGGGGGAGGGGGG + Exonic
1115315553 14:32021328-32021350 GTAAACATCTTATGGGAGGCAGG - Intergenic
1116175043 14:41458195-41458217 GTGAAGAGCATGAGGGAGTGTGG + Intergenic
1116797467 14:49407333-49407355 GTGAACATCTTAAGGCAGGATGG + Intergenic
1118042314 14:61930588-61930610 GTGAACATCTTGAGGGGATGTGG - Intergenic
1118377891 14:65192712-65192734 GTGGACATCTTGGGGTTGGGGGG - Intergenic
1118540183 14:66814377-66814399 GTGAACACCTGCAGGGAGGCAGG + Intronic
1121406635 14:93723069-93723091 CTGAACAACTTGAGGGAGGGAGG - Intronic
1121504757 14:94468358-94468380 GTGAACATGTGGATGAAGGGAGG + Intronic
1123582109 15:21725109-21725131 GTGAACACCTGCAGGGAGGCAGG - Intergenic
1123618759 15:22167705-22167727 GTGAACACCTGCAGGGAGGCAGG - Intergenic
1126451023 15:48809925-48809947 GAGGGCATCTTGAAGGAGGGTGG - Intronic
1126879123 15:53075722-53075744 GTAAACATCCTGAAGGAGAGAGG - Intergenic
1127376383 15:58388897-58388919 GTGCACAGCTTGATGGTGGGGGG + Intronic
1130578512 15:85114821-85114843 GTGAAAATGATGAGGGATGGGGG + Intronic
1131324374 15:91428338-91428360 GTGAACATCTTGGTGGTGGTGGG - Intergenic
1134810271 16:17161280-17161302 GATGACATCTTGGGGGAGGGAGG + Intronic
1136450802 16:30353421-30353443 GCGAACATGTCCAGGGAGGGTGG + Exonic
1137857431 16:51808876-51808898 GTGCACATGAAGAGGGAGGGAGG + Intergenic
1137927406 16:52553662-52553684 TGGAACATCTTGAGGTAGGATGG + Intergenic
1139182289 16:64762384-64762406 ATTAACATAATGAGGGAGGGTGG + Intergenic
1141701002 16:85642017-85642039 TGGAACAGCTGGAGGGAGGGCGG - Intronic
1144148970 17:12424850-12424872 ATGAACATTTTGAGTGAGGAGGG + Intergenic
1145184495 17:20782601-20782623 GTGAACACTTTTTGGGAGGGGGG + Intergenic
1146639632 17:34530563-34530585 GTACACAGCTTGTGGGAGGGAGG + Intergenic
1148411885 17:47474449-47474471 GTGAACACTTTTTGGGAGGGGGG - Intergenic
1149288824 17:55195767-55195789 GTAAACTTCTTGAGGGCAGGGGG + Intergenic
1149435980 17:56633899-56633921 CTGAACAGCTTCAGGAAGGGAGG - Intergenic
1150434861 17:65145900-65145922 GGGAACATTTTGAGGGAGTTCGG - Intronic
1150711225 17:67532328-67532350 TTGAGCATTTTGAGAGAGGGAGG + Intronic
1152114829 17:78378977-78378999 CTGGCCTTCTTGAGGGAGGGTGG + Intronic
1152187543 17:78867397-78867419 GTGAGCATGTTAAGGAAGGGAGG + Intronic
1152397351 17:80041856-80041878 GTGAACATCATCAGGAATGGTGG - Intronic
1153052554 18:913751-913773 GTGATCATCTTTGGGGCGGGGGG + Intergenic
1153761875 18:8339494-8339516 GTTCACACCTTGAGAGAGGGAGG + Intronic
1154451071 18:14475072-14475094 GTGAGGATCTTGGAGGAGGGTGG - Intergenic
1155102927 18:22630974-22630996 GTGGACATCTTGGGGGTGGAGGG + Intergenic
1155234919 18:23809699-23809721 GGTAACAGCTTGGGGGAGGGAGG + Intronic
1155488571 18:26373784-26373806 GTGAACAGAGGGAGGGAGGGAGG - Intronic
1158175130 18:54647361-54647383 AAGAACACCTTGAGGGAGAGGGG + Intergenic
1160735892 19:662368-662390 GTAAACACCTGGAGGAAGGGTGG + Intronic
1160739340 19:678816-678838 GGGCACATCTTGAAGGAGGTGGG + Intronic
1163586753 19:18168551-18168573 GTGACCGTCTGGAGGGAGGCAGG + Intronic
1164286269 19:23820379-23820401 GAGAACATATTGAAGGAGGATGG - Intronic
1164797741 19:31047992-31048014 ATGAACATCTTTAGGGGTGGAGG - Intergenic
1165069989 19:33249457-33249479 GGCAACATCTGGAGGGAAGGAGG + Intergenic
1165439537 19:35816739-35816761 GTGAACACCATGAGGTCGGGGGG + Intergenic
1165718302 19:38061418-38061440 CTCAACATCTGCAGGGAGGGAGG - Intronic
1165743238 19:38216064-38216086 GTGCAGACCTGGAGGGAGGGAGG - Intronic
1165891911 19:39117728-39117750 CTGAAGATCTGGAGGGAGGAAGG - Intergenic
1165909531 19:39216570-39216592 GTCAACATGTGGAGGAAGGGAGG + Intergenic
1166539435 19:43595531-43595553 GTTTCCATCTAGAGGGAGGGCGG - Intronic
1166782475 19:45349680-45349702 GTGAGCAACGTGAGGGTGGGGGG + Intronic
1167259576 19:48450800-48450822 GAGAACACGGTGAGGGAGGGTGG + Exonic
925511872 2:4636811-4636833 GGGAACAACATGAAGGAGGGAGG - Intergenic
926727588 2:16010487-16010509 GTGTACATCCTGAAGGAAGGAGG - Intergenic
927937555 2:27084191-27084213 GTGAGCAGCCAGAGGGAGGGCGG - Intronic
928248961 2:29657979-29658001 CTGAACAGCTGGAGGGATGGTGG + Intronic
928637857 2:33266371-33266393 GACAACATGTTGATGGAGGGAGG + Intronic
929469784 2:42179930-42179952 GTGTACATATAGAGGGAGGGAGG + Intronic
929720351 2:44361773-44361795 GTAGCCATCTTGAGTGAGGGCGG - Intronic
935449313 2:103190573-103190595 GTGAACACCTTCATGGAGGCAGG + Intergenic
935897754 2:107755909-107755931 GTGAATATCTTTTGGGAGGGGGG + Intergenic
935898135 2:107759817-107759839 GTGAACATCTCCAGACAGGGTGG + Intergenic
937003743 2:118492202-118492224 ATGAGCATTTTGATGGAGGGAGG + Intergenic
937206466 2:120239849-120239871 GGGAATTTCTGGAGGGAGGGGGG + Intergenic
938626372 2:133113613-133113635 CTGAACATCATGAGGCAGAGGGG - Intronic
938813194 2:134872603-134872625 GTTAACAGCTTGAGGGACAGAGG - Exonic
939147720 2:138436418-138436440 GTGAACTTCTTGAAGAAGTGGGG - Intergenic
939580075 2:143937218-143937240 GGGAACATGTCGAGGGACGGGGG - Intergenic
942207106 2:173630110-173630132 GTGCACCTTTTGAGGGTGGGAGG - Intergenic
944382437 2:199127187-199127209 GTGAACATCTTGGGGAGTGGGGG - Intergenic
945660654 2:212681500-212681522 GTAAACATCATGAGGCAGGTGGG + Intergenic
946923672 2:224604498-224604520 GTCAACTTCTTGAGAGTGGGCGG + Intergenic
1170598112 20:17820704-17820726 GCGAGCTTCATGAGGGAGGGCGG - Intergenic
1170750983 20:19144847-19144869 GTGAACATCTTTAGGGAAGGGGG - Intergenic
1171121112 20:22569148-22569170 GTGAACACCTAGATAGAGGGAGG + Intergenic
1173250169 20:41360231-41360253 GTGAACATCTTGGGAGGGTGGGG + Exonic
1174469349 20:50744644-50744666 GTGAAAAGCAGGAGGGAGGGAGG - Intronic
1175039623 20:56035905-56035927 GTGAACATCTTTAGGGGTGAGGG + Intergenic
1175332446 20:58174912-58174934 GTGAACTTGTGGAGGGAGTGAGG - Intergenic
1176087255 20:63303808-63303830 CTGCACACCTGGAGGGAGGGAGG - Intronic
1176087369 20:63304208-63304230 GTGCACACCTGGAGGGAGGAAGG - Intronic
1176087478 20:63304568-63304590 GTGCACACCTGGAGGGAGGAAGG - Intronic
1176087524 20:63304728-63304750 TTGCACACCTCGAGGGAGGGAGG - Intronic
1178755933 21:35349742-35349764 TTCAACAGTTTGAGGGAGGGTGG + Intronic
1180167310 21:46036771-46036793 GTGAGCAGCTGGAGCGAGGGGGG + Intergenic
1180571717 22:16728918-16728940 GTGGACACTTTGAGGGAGAGGGG - Intergenic
1181532526 22:23525033-23525055 GTGGACATATTGGGGGAGGGGGG - Intergenic
1181669584 22:24419923-24419945 GTGAACATCTTGAGTGGGGTGGG + Intronic
1182724493 22:32432419-32432441 GTGAGCATCATGATGGAGGCAGG + Exonic
1182875977 22:33691247-33691269 ATTGACATTTTGAGGGAGGGAGG + Intronic
1184665442 22:45986651-45986673 CTGAAGATTTTGAGAGAGGGGGG + Intergenic
1185245110 22:49769348-49769370 GTGAGCATCTGGAGGAAGGGAGG - Intergenic
1185354844 22:50362073-50362095 GAGAACCTCTTGAGCCAGGGAGG - Intronic
950882707 3:16336064-16336086 GTGGAGATCTAGAGGCAGGGTGG + Intronic
951575678 3:24111369-24111391 TTGAACACCTTGAGTGATGGGGG + Intergenic
952193687 3:31050063-31050085 GTGTACATCTTGGGGAAGGAAGG + Intergenic
952961896 3:38597570-38597592 GAGGACATCTTGGAGGAGGGAGG - Intronic
953135359 3:40177181-40177203 GAGAACAGCTTGAGGAAAGGTGG - Intronic
954762096 3:52882391-52882413 GTGAACATCATGAGTGGGGATGG + Intronic
955865360 3:63376592-63376614 GTGAATATCTTGGGAGAGGTGGG - Intronic
956393386 3:68799106-68799128 GTGAACATCTTGAGGGAGGGGGG - Intronic
957106476 3:75895555-75895577 GTGGACACTTTGAGGGAGAGGGG + Intergenic
958156717 3:89764146-89764168 GTGAAGATATTGTGTGAGGGAGG - Intergenic
961438390 3:126935266-126935288 CTGCTCATCTTGAGGGAGGGAGG - Intronic
962812432 3:138971230-138971252 GAGAACAGCCTGAGGGAGGAAGG - Intergenic
963670648 3:148247928-148247950 GTGATCATCTTGTGGTAGGAGGG - Intergenic
963940138 3:151089045-151089067 GTAGAAATCTTGAGGGAGGTAGG - Intronic
964593735 3:158397905-158397927 GTGAAGATTTTTAGAGAGGGTGG + Intronic
964850209 3:161087961-161087983 ATGAACAACATGAGGAAGGGTGG + Intronic
965186439 3:165471367-165471389 GTGAAAATTCTGAGGGAGGAAGG + Intergenic
966216724 3:177511041-177511063 GGAACCATCTGGAGGGAGGGTGG + Intergenic
967988398 3:195113259-195113281 GTGAACATCTGGCGGGAGCTCGG + Intronic
969844886 4:9912732-9912754 GTGAACATTTTGAGAGCGGGGGG - Intronic
970224116 4:13839324-13839346 ATGGACATCTTTAGGGATGGAGG + Intergenic
972324693 4:38004338-38004360 GTGTGCAGGTTGAGGGAGGGAGG - Intronic
972374504 4:38457966-38457988 CTCCACATGTTGAGGGAGGGAGG - Intergenic
973195315 4:47433084-47433106 GTGAGCATCATGATGGAGAGAGG + Intergenic
973294462 4:48501123-48501145 AACAACATGTTGAGGGAGGGGGG + Intronic
976145946 4:82043223-82043245 GGCAATCTCTTGAGGGAGGGCGG + Intronic
977687106 4:99859733-99859755 GTGGACATCTGTAGTGAGGGTGG - Intronic
980265789 4:130513906-130513928 GTGAACATATTGAGGTAAAGTGG - Intergenic
982533241 4:156574318-156574340 GGGAACTACTAGAGGGAGGGGGG + Intergenic
988320761 5:29693264-29693286 GTGGACTTCTAGAGGGAGGAGGG - Intergenic
988731375 5:33976355-33976377 ATAAACTTCTTGAGGGAAGGGGG - Intronic
990781785 5:59372741-59372763 GTGAACATCTGCAAGGAGGCAGG + Intronic
991001568 5:61788706-61788728 GTGAACATCTGGCCTGAGGGTGG + Intergenic
992626218 5:78637938-78637960 GTGAACAGTGTGAGGGAGGAAGG - Intronic
993131901 5:83908765-83908787 ATGAACATCTTGGGAGTGGGTGG - Intergenic
993483286 5:88451024-88451046 TTAAAGATCTTGAGGTAGGGGGG - Intergenic
993573242 5:89568813-89568835 TGGAAGATGTTGAGGGAGGGTGG - Intergenic
998188676 5:140003277-140003299 ATGAACATATTGGGGGAGGGGGG - Intronic
998215385 5:140234842-140234864 GTAAAGACCTCGAGGGAGGGAGG - Intronic
999291900 5:150431221-150431243 GTGAACTGCTTGAGGATGGGTGG + Intergenic
1004167335 6:13268396-13268418 GTGGACATCTTGTGGAAGGGTGG - Intronic
1005275370 6:24211409-24211431 GTGGACATCTTGGGGGTGGGGGG - Intronic
1005400574 6:25429149-25429171 ATGAGCATCTTGTGGGATGGTGG + Intronic
1005665354 6:28047214-28047236 GTGAATAACTGGAGGGAGGCTGG - Intergenic
1005987978 6:30885896-30885918 GTGAAGGGCTTGAGGCAGGGTGG + Intronic
1006405983 6:33845068-33845090 GAGAACACCTTGGGGCAGGGAGG + Intergenic
1006482509 6:34308369-34308391 GTGGACAACTTGAGGCTGGGAGG + Intronic
1006871325 6:37254854-37254876 ATGAAAATTTTGGGGGAGGGGGG + Intronic
1007494034 6:42246986-42247008 GTGAGCATCTTGAGGGTGGAGGG - Intronic
1007725585 6:43913834-43913856 GTGGGCAGCTGGAGGGAGGGAGG + Intergenic
1009446901 6:63753659-63753681 CCCAACATCTAGAGGGAGGGAGG - Intronic
1010777608 6:79905218-79905240 GAAAACAAATTGAGGGAGGGAGG + Intergenic
1016427356 6:143948801-143948823 TTGAACACACTGAGGGAGGGAGG - Intronic
1019755036 7:2762731-2762753 GTGCACTTCCTGCGGGAGGGAGG - Intronic
1020118891 7:5491887-5491909 CTGAACACCATGAGAGAGGGCGG + Intronic
1022116405 7:27264804-27264826 GTGAATATGTGGAGGGAGCGGGG - Intergenic
1023203504 7:37723474-37723496 GTGGACATGGTGAGGGAGGGAGG + Intronic
1023496347 7:40801336-40801358 CAGAACATCTTGTGGGGGGGAGG + Intronic
1023652992 7:42390292-42390314 CCCAAGATCTTGAGGGAGGGGGG - Intergenic
1024730379 7:52247159-52247181 GGAATCATCTTGAGGGAGGATGG + Intergenic
1026135667 7:67658407-67658429 TTCCATATCTTGAGGGAGGGGGG + Intergenic
1028010797 7:85641209-85641231 GTGAACACCTTTAGGAATGGTGG - Intergenic
1030613254 7:111711626-111711648 CTGAACAGCTTCAGGGAGTGTGG + Intergenic
1030809216 7:113955238-113955260 GTGAACACCTGCAGGGAGGCAGG - Intronic
1031024356 7:116663882-116663904 GTCACCATCAGGAGGGAGGGGGG + Intergenic
1032878331 7:136062064-136062086 GTGAAAAGCTTGAGGGAAGTAGG - Intergenic
1034955798 7:155333845-155333867 GTGAACATCTGGCGGAAGAGAGG + Intergenic
1035613557 8:985917-985939 AAGAGCATCTTCAGGGAGGGAGG - Intergenic
1037730895 8:21523304-21523326 CTGAACTTCTTGGGGGTGGGGGG + Intergenic
1038179052 8:25209373-25209395 GCGAACATTGTGAGGGAGCGGGG + Intronic
1042109201 8:65361367-65361389 GTGGACATCTTGAGTGGGGGAGG + Intergenic
1042559406 8:70061800-70061822 GTGAAGAGCTAGGGGGAGGGAGG - Intronic
1046916151 8:119680352-119680374 GGGAACGTCATGAGGGATGGTGG - Intergenic
1047724857 8:127675119-127675141 GTGAACACCAGGAGGGAGGCAGG + Intergenic
1047996753 8:130343773-130343795 GGGAGCAACTTAAGGGAGGGAGG + Intronic
1048088095 8:131206454-131206476 ATGAACATCTGGGGGGAGGGGGG + Intergenic
1048317273 8:133371530-133371552 GGGAACATGCTGAGGGAGAGGGG + Intergenic
1048370403 8:133771809-133771831 CTGGACATGTTGAGGGTGGGAGG + Intergenic
1049276167 8:141721123-141721145 GCTAACAGCTTGAGGAAGGGCGG - Intergenic
1050336630 9:4595963-4595985 ATGAACACCTTGTGGGAGGATGG + Intronic
1050365759 9:4872338-4872360 GGAAACATCCTGAGGGAAGGAGG - Intronic
1051959937 9:22747226-22747248 CTAAACATTTAGAGGGAGGGAGG - Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057504275 9:95619857-95619879 GAGGACATCTTGAGGGATGCAGG - Intergenic
1058318735 9:103602447-103602469 GGGGACTTCTTGAGGGTGGGGGG + Intergenic
1060012378 9:120055218-120055240 GTTAAAATCTGGAGTGAGGGGGG + Intergenic
1061281179 9:129598262-129598284 GTGAACAGCCTGAGGCAGAGGGG + Intergenic
1061566840 9:131446403-131446425 GTGACAAGCTGGAGGGAGGGCGG + Exonic
1185847655 X:3454009-3454031 GTGGACAGCTTGAGGAAGTGGGG - Intergenic
1187885684 X:23886725-23886747 GTGAGCATGCTGAGGCAGGGTGG - Intronic
1187973746 X:24684349-24684371 GTGAAAATCTTGAAGGAAGTTGG + Intergenic
1188068249 X:25687728-25687750 GTGGACTTATGGAGGGAGGGTGG + Intergenic
1188992376 X:36837805-36837827 ATGAACAAGTTGAGGAAGGGTGG - Intergenic
1189685397 X:43558878-43558900 GTGATTACCTTTAGGGAGGGAGG + Intergenic
1192849201 X:74936204-74936226 GTGAACAGCTTGAGAGAGAAAGG + Intergenic
1197075013 X:122343368-122343390 TTTAACATCTTGAGGTCGGGCGG + Intergenic
1198891997 X:141407260-141407282 GAAAACATTTTGAAGGAGGGAGG + Intergenic
1199707112 X:150437278-150437300 GTGAACATCTGCATGGAGGCTGG - Intronic
1199910054 X:152276905-152276927 GTGAATATCTTTGAGGAGGGAGG + Intronic
1200068253 X:153515254-153515276 GGGAACATGCTGAGGGATGGAGG - Intergenic
1200247891 X:154535554-154535576 CTGCACATCCAGAGGGAGGGAGG + Intronic
1201900855 Y:19045215-19045237 GTGCACACCTTGATGGAGAGGGG - Intergenic