ID: 956401367

View in Genome Browser
Species Human (GRCh38)
Location 3:68883402-68883424
Sequence AAAGAGAGACTATCCTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 5, 2: 28, 3: 98, 4: 286}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956401367 Original CRISPR AAAGAGAGACTATCCTGGGT GGG (reversed) Intronic
900937873 1:5778337-5778359 CAAGGGAGATCATCCTGGGTGGG - Intergenic
901843887 1:11970477-11970499 AAAGGGAGATTATCCTGGGGGGG - Intronic
904213238 1:28899465-28899487 AAAGGGAAACTGTCATGGGTGGG - Intronic
905072868 1:35242819-35242841 AAAGGAAGATTATCCTGGGTAGG + Intergenic
905107393 1:35572674-35572696 AGAGAGAGACTTGCCTGGGATGG - Intergenic
905319323 1:37104746-37104768 AGAGGGAGACAATCCTGGCTTGG + Intergenic
906092738 1:43196379-43196401 AAAGAGATGCTATGCTGGGTAGG - Intronic
908387380 1:63655274-63655296 AAAGACCAATTATCCTGGGTTGG - Intronic
909723972 1:78811479-78811501 TAAGGGAGATTATCCTGGGTAGG + Intergenic
909752279 1:79177532-79177554 AAAGAGAGATTTTCCTGAATGGG + Intergenic
909786594 1:79621558-79621580 AAAGAGAGAGAATGCTGGGTAGG + Intergenic
910201792 1:84707639-84707661 AAAAGGAGATTATCCTGAGTGGG + Intergenic
910268390 1:85365902-85365924 AAAGGGAGATTACCCTGGGTGGG + Intronic
910752968 1:90654344-90654366 AAAGGGAAATTATCCTGGGTGGG - Intergenic
911019984 1:93376105-93376127 AAAGAGAGACTACATTGGTTTGG + Intergenic
911459234 1:98168741-98168763 AAAGGGAGATTATCCTGGATGGG + Intergenic
912501598 1:110126328-110126350 TTAGGGAGATTATCCTGGGTGGG + Intergenic
916381085 1:164211259-164211281 AAAGAGTTACTATGCTGGCTGGG + Intergenic
916726712 1:167530017-167530039 AAAGGGAGAGTGTTCTGGGTGGG - Intronic
916970600 1:170009754-170009776 TACGTCAGACTATCCTGGGTTGG - Intronic
917043065 1:170827874-170827896 AAAGAGAGGCTATTGTGGGAGGG + Intergenic
918344609 1:183595749-183595771 AAAGGGAGAATATTCTGGGTGGG - Intronic
919310655 1:195902879-195902901 AAAGGGAGATTATTCTGGGCAGG + Intergenic
919650690 1:200146405-200146427 AAAAACCGACTATCCTGTGTTGG - Intronic
922083711 1:222324861-222324883 AAAGGGAGATTATCCTAGGTGGG - Intergenic
922557439 1:226543204-226543226 AATGGGAGATTATCATGGGTGGG - Intergenic
922759365 1:228116747-228116769 AAAGAAAGACCATCTTGGGCTGG + Intergenic
923276342 1:232400180-232400202 GAAGTGAGTCTATCCAGGGTGGG - Intronic
923496395 1:234529285-234529307 AAAGAGAGATTATCCTGGGTGGG + Intergenic
924736668 1:246763277-246763299 ACCCAGAGACTATGCTGGGTCGG + Intronic
1063733522 10:8725522-8725544 AAAGGGAAACGATCCTGGGTGGG - Intergenic
1066018912 10:31276954-31276976 AAAGAGAGATTATCCTGGTTGGG + Intergenic
1067545895 10:47192582-47192604 AAAGGGAGATTATCCTAAGTGGG - Intergenic
1067558437 10:47288013-47288035 AAAGGGAGATTATCCTGGGTGGG - Intergenic
1068146056 10:53072029-53072051 AAAGGGAGATCATCTTGGGTAGG + Intergenic
1068194597 10:53699318-53699340 TAAGGGAGATTATCCAGGGTGGG - Intergenic
1068799126 10:61119770-61119792 AAAGGGAGACTATTCTGGGTGGG - Intergenic
1068987745 10:63122837-63122859 AAGGAGAGATTCTCTTGGGTGGG - Intergenic
1069081945 10:64097963-64097985 AAGGGGAGACTATACTGGTTAGG + Intergenic
1069440193 10:68421456-68421478 AAAGAAAGACTATTTTGGGCCGG + Intronic
1069606627 10:69742982-69743004 AAAGAGAGACTAACTGGGGTTGG + Intergenic
1070274541 10:74992923-74992945 AGAGAGTGACTATCGTGGATTGG + Intronic
1070764711 10:79049625-79049647 AAAGATAGACTTTGCTGGCTCGG + Intergenic
1071083281 10:81838501-81838523 AAAGGGAGATTATCCTGGGTGGG - Intergenic
1072683168 10:97521243-97521265 AAGGTGAGACTCTGCTGGGTGGG + Intronic
1072723298 10:97794198-97794220 AAAGTGAGATGATCCTGGGTAGG - Intergenic
1074276382 10:112006278-112006300 AGAGAGAGAGGATCCTGGGCTGG - Intergenic
1074599784 10:114901767-114901789 ATGGGGAGATTATCCTGGGTGGG - Intergenic
1074911310 10:117911876-117911898 AAAGAGAGATTATCCTGGGTGGG - Intergenic
1075538252 10:123289642-123289664 AAAGGGAGATTATCCTAGGTGGG - Intergenic
1075816006 10:125265283-125265305 AAAGAGAGAGAATCCAGGGAGGG + Intergenic
1076759322 10:132593132-132593154 AAAGGGAGATAATCCTGGGTGGG - Intronic
1077591088 11:3491529-3491551 AAAGGGAGATTATTCAGGGTGGG + Intergenic
1077908451 11:6553168-6553190 AAACGGAGTCTATCCTGGGAAGG + Intronic
1078553695 11:12300427-12300449 AAAGAGAGATTGTCCTGGGTGGG + Intronic
1078996808 11:16710062-16710084 AAAGAGAGGGTATCTTGGATTGG + Intronic
1080833858 11:35921552-35921574 AAAGGGAGATTATCCTGAGTAGG - Intergenic
1081039160 11:38189406-38189428 TAAGAGAGATTATCCTGGGTGGG - Intergenic
1081042007 11:38224694-38224716 TAAGAGAGAATATCCTGAATGGG - Intergenic
1081352672 11:42073521-42073543 AAATAGAGATTATCTTGGGTTGG - Intergenic
1081859221 11:46322876-46322898 AAAGGTAGATGATCCTGGGTGGG + Intergenic
1084246801 11:67863280-67863302 AAAGGGAGATTATTCAGGGTGGG + Intergenic
1084482353 11:69429323-69429345 AAATGGAGATGATCCTGGGTGGG + Intergenic
1084825878 11:71731212-71731234 AAAGGGAGATTATTCAGGGTGGG - Intergenic
1085183628 11:74557136-74557158 CAAGAGAGATTATCTTGGGTGGG + Intronic
1085198390 11:74686002-74686024 AAAGGGAGATTATGCTGAGTGGG + Intergenic
1085463126 11:76707107-76707129 AAAGACAGACAGACCTGGGTTGG + Intergenic
1085536728 11:77225481-77225503 AGAGAGAGACTATCTTGATTAGG - Intronic
1087127279 11:94640484-94640506 AAAGGGAGATAATCCTGGGTGGG + Intergenic
1088086627 11:105988353-105988375 AAAGGGAGATTATCCTAGGTGGG + Intergenic
1088546891 11:110968327-110968349 AAAGAGAAGTTATCCTGGATGGG + Intergenic
1088712600 11:112522025-112522047 AAAAAGAGATTATCCTGGATTGG + Intergenic
1089628933 11:119771431-119771453 AAAGGAATAATATCCTGGGTGGG - Intergenic
1090177644 11:124665318-124665340 AAATTGAGATTTTCCTGGGTTGG + Intronic
1090986602 11:131772397-131772419 AAAAGGAGATTATCCTGGGTGGG + Intronic
1091743908 12:2978747-2978769 GAAGAGAGACTATCAGGGGTTGG - Intronic
1093169287 12:15841366-15841388 ATAGAGAGACTGTCCTGTGCTGG + Intronic
1093536419 12:20229090-20229112 AAAGGGAGATTATCTTGTGTAGG + Intergenic
1093554805 12:20459082-20459104 AAAGAAACACTATACTGGGAAGG - Intronic
1095200845 12:39381818-39381840 AAAGGGAAATCATCCTGGGTGGG + Intronic
1095487488 12:42700007-42700029 AAAGGGAGAATATCCTGAGTGGG - Intergenic
1095865826 12:46971282-46971304 AAAGGGAGATTATCCTAAGTGGG + Intergenic
1096407781 12:51356334-51356356 AAAGAGAAAATATACTGGTTGGG - Intronic
1097072596 12:56366047-56366069 AAAAAGAGAATATACTGGATGGG + Intergenic
1097900624 12:64869950-64869972 AAAGAGAAACAATACTAGGTGGG - Intronic
1098854910 12:75641550-75641572 AAAGGGTGATTATCCTTGGTGGG + Intergenic
1099625865 12:85072898-85072920 AAAGAAGGAATATCCTGAGTAGG - Exonic
1101709024 12:107247822-107247844 AAAGGGAGATGATCCTGGGTGGG + Intergenic
1105704431 13:22960612-22960634 AAAGGGAGATTTTTCTGGGTGGG - Intergenic
1105857382 13:24385663-24385685 GAAGGGAGATTATTCTGGGTGGG - Intergenic
1106328439 13:28717008-28717030 AAAGAGATAGTATCCAGGTTTGG - Intronic
1108284212 13:48890017-48890039 AAAGGGAAACTAACCTGGGTGGG + Intergenic
1109483395 13:62986377-62986399 TAAGGAAGACTATTCTGGGTGGG + Intergenic
1109637065 13:65134695-65134717 CAAAAGAGATTATTCTGGGTTGG + Intergenic
1110733248 13:78905450-78905472 ACAGGGAGATTATCCTGGGTGGG + Intergenic
1111788780 13:92826232-92826254 AAAGGGAGATTATTCTGGGAGGG + Intronic
1111944433 13:94648769-94648791 AAAGAGAGATAAGCCTGAGTGGG - Intergenic
1112047999 13:95616865-95616887 AAAGGAAGATTATCCTGTGTGGG + Intronic
1112661269 13:101511531-101511553 AAAGAGAAATTTTACTGGGTGGG + Intronic
1113455062 13:110442565-110442587 AAAGAAAAGATATCCTGGGTAGG + Intronic
1114202510 14:20535708-20535730 AAAGGGATATTATCCTTGGTGGG - Intergenic
1115210857 14:30966423-30966445 AAACAGAGACTGTCCCTGGTGGG - Intronic
1115536443 14:34377698-34377720 AAAGAGAGACATTTCTGGCTTGG - Intronic
1115699135 14:35932290-35932312 ATTGAAAGATTATCCTGGGTGGG + Intronic
1116378724 14:44236817-44236839 AAAGAGAGATTGTCCTGTTTGGG - Intergenic
1116448252 14:45037288-45037310 AAAGGGAGATTATCCTGGGGAGG - Intronic
1116512555 14:45764857-45764879 AAAGAGAGATTATCCTATATGGG - Intergenic
1118393472 14:65316031-65316053 AAAGGGAGATTATCCTGGGCAGG + Intergenic
1120457379 14:84749381-84749403 AAAGAGAGACTATTCCAGGCAGG - Intergenic
1120540893 14:85749042-85749064 AAAGAGAGATTATTCTGGGTGGG + Intergenic
1120738942 14:88086441-88086463 AAAGATAAATTACCCTGGGTGGG + Intergenic
1120946243 14:90000238-90000260 AAAGGGAAACAATCCTGGGTGGG - Intronic
1122236297 14:100332411-100332433 ACAGAGAGACTGAGCTGGGTTGG + Intergenic
1123477300 15:20598879-20598901 AATGAGAGACTCTCCTGCGATGG - Intergenic
1123640713 15:22401485-22401507 AATGAGAGACTCTCCTGCGATGG + Intergenic
1124018804 15:25901713-25901735 AAAAGGAGATTATCCTGAGTGGG + Intergenic
1124660817 15:31549557-31549579 AAAGGGAGATTATCCTGGGTTGG + Intronic
1129583769 15:76840912-76840934 AACGATAAACAATCCTGGGTGGG - Intronic
1132206031 15:99986860-99986882 AAAGAGCTACTATCCCGGGTGGG + Intronic
1133356467 16:5140560-5140582 AAAGGGAGATTATTCAGGGTGGG + Intergenic
1133668894 16:7998313-7998335 AAAGAGCAAGTATCCTGGGAAGG + Intergenic
1137389942 16:48072861-48072883 AGAGGGAGACCATCCTGGGGTGG + Intergenic
1138198665 16:55073122-55073144 AAAGGGAGATTATCCTGAGTGGG + Intergenic
1138217522 16:55217601-55217623 AAAGGGAGATTATCCTGGGTGGG - Intergenic
1138316254 16:56072752-56072774 AAAGAGTGACCATTATGGGTGGG - Intergenic
1138499132 16:57427870-57427892 AAAGGGAGATTATCCTGAGTAGG - Intergenic
1138888131 16:61105870-61105892 CAAGAGAGATTATCCCAGGTGGG - Intergenic
1139974977 16:70802396-70802418 AAAGAGAGATTAACTTGAGTCGG + Intergenic
1140282270 16:73565723-73565745 AAAAAGGGACTAACCTGTGTAGG - Intergenic
1140429864 16:74893214-74893236 ACAGAGAGACTATCCTGGGTGGG + Intronic
1140622075 16:76746928-76746950 AAAGAGAGAGTCTGCTGGGCCGG + Intergenic
1140913674 16:79476016-79476038 AAAGGGAGATGATCCTAGGTGGG + Intergenic
1141823017 16:86460604-86460626 AAAGGGAGGCTATTCTGGGCTGG + Intergenic
1142598119 17:1039480-1039502 CAGCAGAGACTGTCCTGGGTGGG - Intronic
1142857581 17:2740331-2740353 AAATGGAGATTATTCTGGGTGGG + Intergenic
1148546482 17:48523018-48523040 AATCAGAGTGTATCCTGGGTGGG - Intergenic
1148693678 17:49546832-49546854 AAAGGGAGATTACCTTGGGTGGG - Intergenic
1150850692 17:68701133-68701155 AAAGGGAGCTTATCTTGGGTAGG + Intergenic
1151266834 17:72963027-72963049 AAAGGGAGATTATCCTGGGTGGG - Intronic
1151449412 17:74188874-74188896 AAAGGGAGATTATTCTGGATGGG - Intergenic
1152372654 17:79899625-79899647 AAAGAGAGAATAACAAGGGTTGG + Intergenic
1153110625 18:1582021-1582043 AAAGAGAGATTATCTTGATTGGG - Intergenic
1153250896 18:3120294-3120316 AAAGGGAAATTATCCTGGATGGG + Intronic
1153987374 18:10365172-10365194 AAGGGGAGATTATCTTGGGTGGG + Intergenic
1156088998 18:33442315-33442337 AAAGGGAGATTATCCAGGATGGG + Intergenic
1156349730 18:36293858-36293880 AAAGACAGACAATCCTTGTTTGG + Intergenic
1157577990 18:48756373-48756395 AAATTGAGGGTATCCTGGGTTGG - Intronic
1157749661 18:50167014-50167036 AAAGAGAGACTCCCCTGGAAAGG + Intronic
1157784230 18:50467761-50467783 AAAGGGAGAGTATCCTGGGTGGG - Intergenic
1159406228 18:68006380-68006402 AAAGGGAGATTATCCTGGGTGGG - Intergenic
1159786529 18:72721562-72721584 AAAGAGAGAAGATCCAGGGGAGG + Intergenic
1159892059 18:73962241-73962263 AAAGAGAGATTATCCTGGGAGGG - Intergenic
1161137800 19:2630422-2630444 AAAGGGCGATTATCCTAGGTGGG + Intronic
1162497535 19:11031756-11031778 AAAGAGGGACCCTGCTGGGTTGG - Intronic
1164142844 19:22488580-22488602 AAAGAGACATTATCCTGATTGGG + Intronic
1165851057 19:38850548-38850570 AAAGAGCGCCTACCCTGGGGCGG - Intronic
1165997713 19:39856367-39856389 ACAGGGAGATTATCCTGGATTGG - Intergenic
1167797260 19:51717573-51717595 AAAAGGAGATTATCCTGGGTGGG + Intronic
925229802 2:2223321-2223343 AAAGAGAGAGTATCTTTGCTAGG + Intronic
925782517 2:7394999-7395021 AAAGGGAGATTATGCTGGGCGGG - Intergenic
927740591 2:25566040-25566062 AAAGGGAGATTACACTGGGTGGG + Intronic
927808745 2:26170391-26170413 AAAGAGAGACCCTACAGGGTAGG + Intergenic
928096371 2:28407504-28407526 AAAGAGCCACTGTCCTGGTTGGG - Intronic
929554666 2:42918326-42918348 AGAGAGAGAGTATCCTAGGTTGG + Intergenic
929693367 2:44093035-44093057 AGAAAGAGACAGTCCTGGGTGGG - Intergenic
931012516 2:57933512-57933534 AAATCGAGACTATCCTGGCCAGG - Intronic
931645926 2:64421905-64421927 AAAGGGAGATTACCCTGGGCAGG - Intergenic
931691155 2:64836021-64836043 GAAGAGAGATGATCCTGGGCTGG - Intergenic
932918755 2:75885558-75885580 AAAGATAGAACATCTTGGGTAGG + Intergenic
933120112 2:78525924-78525946 ACATAGAGACTATCCTAGATGGG - Intergenic
936102009 2:109590380-109590402 GAAGGGAGACTATCCTGGTTGGG + Intronic
936723637 2:115285396-115285418 AAAGACAGAGTATACTGGGATGG + Intronic
936946352 2:117934387-117934409 CAAGACAGCCTATCCTGGCTTGG + Intronic
937313265 2:120915158-120915180 AAAGAGAGAGTGTGCTGGGCTGG - Intronic
937382615 2:121394242-121394264 AAAGGGAGATTATCCTGGATGGG + Intronic
937457487 2:122055058-122055080 AAAATGAAACTATCCTGGGCTGG - Intergenic
940786235 2:157984585-157984607 AAAGAGAGACTCTCTTTGTTTGG - Intronic
941732517 2:168934220-168934242 AAAGAGACACTTTCCTAGCTGGG + Intronic
942412884 2:175729889-175729911 AATGACTGACTTTCCTGGGTGGG - Intergenic
942767091 2:179469790-179469812 AAAGAGAGACTTTACTGAGGTGG - Intronic
942987584 2:182161488-182161510 AAAGAGATACCATTGTGGGTGGG - Intronic
943110461 2:183597956-183597978 AAAGAGAGAAAATTCAGGGTAGG + Intergenic
943185017 2:184597497-184597519 AAAGAGAGAATCAACTGGGTGGG + Intergenic
943682680 2:190784817-190784839 AAAGGGAAATTATCCTGGGTGGG + Intergenic
945332978 2:208560988-208561010 AAAGGCAGATTATCCTGGGTGGG - Intronic
945911938 2:215659834-215659856 AAAGGGATATTATCCTTGGTGGG + Intergenic
946102041 2:217333821-217333843 AAAGAGACACTGTGCTAGGTGGG + Intronic
946746304 2:222849133-222849155 AAATAGAGACAATTTTGGGTGGG - Intergenic
948197586 2:236106993-236107015 AATGAGAGAGCACCCTGGGTAGG + Intronic
1168858504 20:1027956-1027978 ACAGAGAGACTCCCCTGGGTTGG - Intergenic
1169556991 20:6761813-6761835 AAAGACAGGTTATCCTGGGTAGG + Intergenic
1169781096 20:9311473-9311495 AAAGAGAGACACTCCTGGTTGGG - Intronic
1169798412 20:9490929-9490951 AAAGGGAGATTATCCTGGTAGGG - Intergenic
1170540185 20:17379810-17379832 AAGGAAAGACTATCCTGGGTGGG + Intronic
1170663510 20:18364979-18365001 AAAGGGAGATTATCTTGGGTGGG - Intergenic
1174359198 20:50017297-50017319 AAGGAGAGTCCATGCTGGGTGGG - Intergenic
1174456285 20:50650908-50650930 AAAGGGAGATTAGCCTGGGTGGG + Intronic
1174474085 20:50783587-50783609 AAAAACAGATGATCCTGGGTGGG - Intergenic
1174901502 20:54505659-54505681 AAAGAGAGAGTATAGGGGGTGGG + Intronic
1175128901 20:56774511-56774533 AAAGGGAGATGATCCTAGGTGGG - Intergenic
1178527848 21:33347605-33347627 AATGAGAGACTATTCTGGGTGGG - Intronic
1179000445 21:37452684-37452706 AAAGAGGGACTAGTGTGGGTGGG - Intronic
1179477580 21:41657663-41657685 AAAGAGAGAGTATGTGGGGTGGG + Intergenic
1180021829 21:45133441-45133463 AAAGGGAGATTTTCCTGGGTGGG - Intronic
1181185189 22:21098332-21098354 AAAGGAAGATTATCCTGGGTGGG - Intergenic
1181971109 22:26690867-26690889 AAAGGAAGGTTATCCTGGGTGGG - Intergenic
1183052993 22:35280069-35280091 AAAGGGAGATTATCCTGACTGGG - Intronic
1183882746 22:40849017-40849039 ATAGAGAGACTATCCTGCAATGG - Intronic
1184560051 22:45257364-45257386 AAAGGGAGATTGTCCTGGGTGGG - Intergenic
951405665 3:22294176-22294198 AAAGTGCCACTATACTGGGTAGG + Intronic
953061281 3:39430291-39430313 GGAGAGAGACTATGCTGGGGAGG + Intergenic
953262411 3:41352661-41352683 AAAAAGTGACTGTCCTGGGAGGG - Intronic
955414997 3:58683937-58683959 ACAGAGAGATTATCCTCAGTGGG - Intergenic
955581405 3:60427044-60427066 AAAGGGAAATTATCTTGGGTGGG + Intronic
956148748 3:66219431-66219453 AAATGGAGATTATCCTGGGTAGG + Intronic
956384638 3:68703655-68703677 AAAGGGAGATTATCCTAGGTGGG - Intergenic
956401367 3:68883402-68883424 AAAGAGAGACTATCCTGGGTGGG - Intronic
957061111 3:75482029-75482051 AAAGGGAGATTATTCAGGGTGGG + Intergenic
957429996 3:80091762-80091784 AAAGAAAGACTATGTTGGCTGGG - Intergenic
957692687 3:83592932-83592954 AAATCGAGACCATCCTGGCTCGG - Intergenic
959162215 3:102736734-102736756 AAAGATAGAGTATCCAGGCTAGG - Intergenic
960035447 3:113097958-113097980 AAAGAAAGACAATCTTAGGTGGG + Intergenic
960140732 3:114149636-114149658 AAAGGGAGATTATCTTGAGTGGG + Intronic
961292274 3:125857387-125857409 AAAGGGAGATTATTCAGGGTGGG - Intergenic
961507421 3:127379227-127379249 AAAGAGGGACTTTTCCGGGTGGG - Intergenic
961894922 3:130159014-130159036 AAAGGGAGATTATTCAGGGTGGG + Intergenic
962210767 3:133475765-133475787 CAAGAGAGTCTTGCCTGGGTAGG - Intergenic
963686579 3:148442566-148442588 AAAGGGAGATTATCCTGGGTTGG - Intergenic
963921570 3:150910651-150910673 AAAGGGAGATTATCCTGGGTGGG - Intronic
965642962 3:170850439-170850461 ACAGAGAGACTATAAAGGGTTGG - Intronic
965774679 3:172216079-172216101 AAAGAGAGAAAATGCTGGGATGG + Intronic
966026950 3:175295922-175295944 AAAGTGAGACTAGCCTGGGTTGG - Intronic
966264947 3:178028642-178028664 AAAGAGAGATTATGCTGGATGGG + Intergenic
968770590 4:2503422-2503444 AAAGGGAGACGCTCCTGGCTTGG + Intronic
969204475 4:5633043-5633065 AAAGGAAGACTCTCCTGGGTGGG + Intronic
969665384 4:8554349-8554371 AACGGGGGATTATCCTGGGTGGG + Intergenic
969747845 4:9088081-9088103 AAAGGGAGATTATTCAGGGTGGG - Intergenic
969808886 4:9632614-9632636 AAAGGGAGATTATTCAGGGTGGG - Intergenic
969970485 4:11042319-11042341 AAAGAGAGATTACCCTTGTTGGG + Intergenic
970224100 4:13839204-13839226 ATAGAGAGATTATTCTGGGTTGG - Intergenic
970233167 4:13932008-13932030 AAAATGAGACCATACTGGGTAGG + Intergenic
970242223 4:14021519-14021541 AAAGAGAGGTCATCCTGGGTGGG + Intergenic
970242232 4:14021558-14021580 AAAGAGAGGTCATCCTGGGTGGG + Intergenic
970507199 4:16743525-16743547 AAAGAGAGATTTTCCTGGGCAGG + Intronic
970550427 4:17174930-17174952 CAACAGAGACTATCCTCTGTGGG - Intergenic
971149361 4:24014784-24014806 AAAGAGAGGTAATCCTGGGTGGG - Intergenic
971509285 4:27404170-27404192 AAACAAAGATTATCCTGGGTGGG - Intergenic
972001067 4:34034034-34034056 AAAGAGAGATTTGGCTGGGTAGG - Intergenic
972003302 4:34066497-34066519 AAAGAGAGATTATTCTGAGTAGG - Intergenic
972869588 4:43280690-43280712 AAAGAGAGATTATCCTGTGTGGG - Intergenic
973878409 4:55243841-55243863 AGGGAGAGACTTTCCTGGCTGGG + Intergenic
973987753 4:56372089-56372111 AAAGGGAGATTATCCAGGGTTGG + Intronic
975271129 4:72434733-72434755 AAAGGGAGAGTATCCTGTGTGGG + Intronic
975372340 4:73603454-73603476 AAGGAGAGACTGACCTTGGTGGG + Intronic
976016643 4:80562534-80562556 AAATAAAGACTATCCTCGGGAGG + Intronic
977247371 4:94648903-94648925 AAAGACAGATCATCCTGGATGGG - Intronic
977690059 4:99895570-99895592 AAAGAGAGATGATCATGGCTTGG - Intergenic
978171260 4:105673035-105673057 AAAGAGGGATTATCCTGGATGGG - Intronic
978841588 4:113220403-113220425 AAAGAAGGAGGATCCTGGGTAGG + Intronic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
979411066 4:120380356-120380378 AAAGGGAGATTATCCTGGGTGGG - Intergenic
979736369 4:124091072-124091094 AAAAAGAGACTGACCTGGTTTGG - Intergenic
980203010 4:129679575-129679597 AAAGAAAGATTCTGCTGGGTGGG + Intergenic
980264578 4:130498774-130498796 AAAGGGAGATTATCCTGTGCTGG + Intergenic
982689284 4:158529803-158529825 AAAGAGAAACTCTCCTGTCTTGG + Intronic
982872885 4:160606678-160606700 AAAGGGAGAATATTCTGTGTGGG + Intergenic
983174611 4:164573612-164573634 AAAGGGACACTGTTCTGGGTTGG + Intergenic
983397608 4:167220676-167220698 AAAGAAATACTAGGCTGGGTGGG - Intronic
986180262 5:5386470-5386492 ATACAGAGATTATCCTGGGTGGG + Intergenic
986207755 5:5641564-5641586 AAAGAAAGCCCACCCTGGGTGGG + Intergenic
987636659 5:20551514-20551536 AAAGAGACACTTTCCTGGCTTGG + Intronic
988085760 5:26473638-26473660 GAAGGGAGATTATCCTAGGTGGG - Intergenic
988392038 5:30646845-30646867 AAAAAGAAACTATTCTGGCTAGG + Intergenic
989433781 5:41386612-41386634 AAAGAGAGATTATCCTGAGTGGG + Intronic
989736636 5:44715563-44715585 GAAGAAAGATTACCCTGGGTAGG - Intergenic
990321408 5:54633065-54633087 AGAGAGATACTACCCTGGGCCGG - Intergenic
990537017 5:56733012-56733034 AAAGAGAGACTATTCCAGGCAGG - Intergenic
990666464 5:58078005-58078027 AAAAAGAAAATCTCCTGGGTAGG + Intergenic
991005544 5:61824625-61824647 CAAGAGAGACAAGCCTGGGAAGG + Intergenic
992481729 5:77158364-77158386 AAAGAGAGATCATCCTAGGCTGG + Intergenic
994611685 5:102049017-102049039 TAAGAGAGACTCTCCAGGGGAGG - Intergenic
995092078 5:108189697-108189719 AAAGGGAAAGTATCCTAGGTGGG + Intronic
995107111 5:108387345-108387367 AAAGGCAGATTATCCTAGGTGGG + Intergenic
995623987 5:114056652-114056674 AAAGAAACATTCTCCTGGGTGGG + Intergenic
995819181 5:116207894-116207916 AATGAGAGACTACTATGGGTAGG + Intronic
995927940 5:117398210-117398232 AAAGAGTGACTTTACTGGTTAGG + Intergenic
996767617 5:127050121-127050143 AAAGGGAAATTATCCTGGCTGGG - Intronic
997366017 5:133325583-133325605 GAAGAAAGACTTGCCTGGGTGGG + Intronic
997631135 5:135369671-135369693 AAAGCAAGACTGTCCTGGGCAGG - Intronic
998404782 5:141868155-141868177 AAAGAGAAACTATCCCTGGTTGG + Intronic
1000346519 5:160319094-160319116 AAAGAGAGAATATCTTTGGAAGG - Intronic
1002709505 5:181186152-181186174 AAAGGGAGATTATCCTGGGTGGG + Intergenic
1004594726 6:17088320-17088342 AAGGAGATATTATCCTGGGTGGG + Intergenic
1004647643 6:17578034-17578056 AATGATAGATTATCCTGAGTGGG - Intergenic
1004883542 6:20031515-20031537 AAAGGGAGATTCTCCTGGGTGGG + Intergenic
1005361851 6:25038440-25038462 AAAGAGAGATTATCCTGGGTGGG + Intronic
1006454858 6:34125814-34125836 AAAGAGAGACTATCTCGGCAGGG + Intronic
1007245105 6:40455860-40455882 TAAGGGAGATTATCCTGGGTGGG + Intronic
1007664024 6:43503940-43503962 AGAGAGAGAAGATCCTGGGCAGG + Intronic
1007993936 6:46286564-46286586 AAAGATGGACTATCCAGGCTGGG + Intronic
1008012925 6:46488249-46488271 AAAGAGAGGATATCTTGCGTGGG - Intronic
1008743194 6:54635443-54635465 AAAGGGAGATTATCCTAGGTGGG - Intergenic
1008771314 6:54982138-54982160 AAAGGGATATTATCCTGGATAGG - Intergenic
1009649852 6:66461564-66461586 AAAGAGACAGCATCTTGGGTGGG - Intergenic
1010402782 6:75466010-75466032 GCAGAGAGAATAACCTGGGTGGG - Intronic
1010486264 6:76418135-76418157 AAAGTGAAATTATCCTGGGTGGG + Intergenic
1010510445 6:76712303-76712325 AAAAGAAGAATATCCTGGGTGGG + Intergenic
1011360582 6:86520027-86520049 AAAAAGAGATTATCTTGGGTAGG + Intergenic
1012007633 6:93734465-93734487 AAAGAAAGATTATCCTAGGTGGG - Intergenic
1012205277 6:96453599-96453621 AAAGAGAGAGAATCCTTGATGGG + Intergenic
1012356181 6:98317152-98317174 AAAAGGAGATTATCCTGAGTCGG + Intergenic
1013045650 6:106482285-106482307 AAAGGGAGATTATCCTGAGTAGG - Intergenic
1013835681 6:114332722-114332744 AAAGATAGCCCATCCTGGCTTGG + Intronic
1014328260 6:120027141-120027163 GAAGACAGATTATCCTGGGTGGG - Intergenic
1015208820 6:130672312-130672334 AAAAAGAGATTATCCTGGGTGGG + Intergenic
1016185817 6:141196592-141196614 AAAGAGATACCATCCTGGCTGGG - Intergenic
1018255192 6:161911541-161911563 ACAGAGACATTATCCAGGGTTGG - Intronic
1018535946 6:164818920-164818942 AAAGAGAGACTCTGCTTGCTTGG + Intergenic
1018580349 6:165302554-165302576 AAAGACAGACTATCTTGATTTGG + Intronic
1019320201 7:411775-411797 CAGGAGAGGCTACCCTGGGTGGG - Intergenic
1020081683 7:5289552-5289574 AAAGGGAAATTACCCTGGGTGGG - Intronic
1020325154 7:6968553-6968575 AAAGGGAGATTATTCAGGGTGGG + Intergenic
1020565840 7:9794478-9794500 AAAGGGATATTATCCTGGGTGGG + Intergenic
1020762261 7:12283208-12283230 AAAGAGTTACTATACTGGGAGGG - Intergenic
1021389988 7:20080697-20080719 AAAGGGAAAATATCCCGGGTAGG + Intergenic
1021785203 7:24144268-24144290 AAAAGGAGATTATCCTGGGTAGG + Intergenic
1022658877 7:32347560-32347582 AAAGAAAGAGCATCATGGGTGGG + Intergenic
1023452482 7:40302698-40302720 AAAAAGAGATTATCTTGAGTGGG - Intronic
1023656516 7:42427977-42427999 AAAGACTGACTCTCCAGGGTAGG + Intergenic
1023879964 7:44312715-44312737 CAAGACAGGCTGTCCTGGGTTGG + Intronic
1024685613 7:51741738-51741760 AAAGGGAGACCATACTGGGTGGG + Intergenic
1025770940 7:64505987-64506009 AAAGGGAGATTATCCTGATTGGG - Intergenic
1025795220 7:64733394-64733416 AAAGAGAGATTATCTTGATTGGG + Intergenic
1025820356 7:64956622-64956644 AAAGGGAGATTATCCTGATTGGG - Intergenic
1028064816 7:86370253-86370275 AAAGATAGAATATACTGTGTTGG - Intergenic
1028657948 7:93232334-93232356 AAAGACAGGATACCCTGGGTCGG + Exonic
1029787679 7:102808986-102809008 AAACAAAGGTTATCCTGGGTGGG - Intronic
1030315189 7:108107063-108107085 AAAGAGTGCTTATGCTGGGTTGG + Intronic
1031221205 7:118967994-118968016 AGGGGGAGATTATCCTGGGTGGG - Intergenic
1032091943 7:128915505-128915527 AAAGTGAGACTAGCATGGCTGGG - Intergenic
1032618064 7:133496905-133496927 AAAGGGAGATTACCCTGGTTGGG + Intronic
1032969878 7:137148487-137148509 AAAGGGAGATTGTCCTGGGTGGG - Intergenic
1034384680 7:150730393-150730415 AAGGGGAGATTATTCTGGGTAGG - Intronic
1034595127 7:152182251-152182273 TGAGAAAGACTATCCTGGATGGG + Exonic
1036370910 8:8162276-8162298 AAAGAGAGATTATTCAGGGTGGG - Intergenic
1036879984 8:12503360-12503382 AAAGAGAGATTATTCAGGGTGGG + Intergenic
1037218989 8:16493904-16493926 AAAGAAAAACTATCCTGAGAAGG + Intronic
1037871549 8:22502074-22502096 AAAGAAAGATTATCTTGGGAGGG - Intronic
1039186448 8:34922684-34922706 AAAGAGAAACAATTCTGAGTAGG + Intergenic
1040578001 8:48671118-48671140 AAAGAGGAATTATCCTAGGTGGG - Intergenic
1040784918 8:51154506-51154528 AAAGAGAGATCATCCTGAGTGGG - Intergenic
1040958478 8:53005110-53005132 AAAGAGAGATCCTCCTGGGTGGG - Intergenic
1041745984 8:61210003-61210025 AAAGAAAGATTATCATGGGTGGG + Intronic
1041926168 8:63238824-63238846 AAAGAGAGATTGGCCTGGGATGG - Intergenic
1042244285 8:66695067-66695089 TAAGATAGAATATCCTTGGTGGG - Intronic
1042388723 8:68207790-68207812 AGAGAGAGAATTTCCTGAGTTGG - Intronic
1044937411 8:97306460-97306482 AAAAGGAGATGATCCTGGGTGGG - Intergenic
1044942617 8:97358791-97358813 ACAGTCAGACTAACCTGGGTTGG - Intergenic
1045287115 8:100801417-100801439 AAAGGGAATTTATCCTGGGTAGG + Intergenic
1046473270 8:114707854-114707876 AAAGAGAGATCATCTGGGGTAGG - Intergenic
1046608928 8:116402966-116402988 AAAGGGAGAATATCCTGAGTGGG - Intergenic
1047311265 8:123694357-123694379 AAAGGGAGATTATCCTTGGCCGG + Intronic
1048603893 8:135947610-135947632 GCAGAGAGATTATCCTTGGTGGG - Intergenic
1048840591 8:138562634-138562656 AAAGGGAGGTTATCCTGGATGGG - Intergenic
1049912265 9:280624-280646 AAGGAGAGATTCCCCTGGGTGGG - Intronic
1050199965 9:3134031-3134053 AAATTGAGATGATCCTGGGTTGG + Intergenic
1050761055 9:9071366-9071388 AGAGGGAAATTATCCTGGGTGGG + Intronic
1051008259 9:12376846-12376868 AAGGGGAGACTATCCCGAGTAGG - Intergenic
1051238145 9:15023577-15023599 AAAGACAGAGTATAATGGGTAGG - Intergenic
1051362288 9:16291842-16291864 AAAGAAAGACTATCCTGAGTGGG - Intergenic
1051724346 9:20073350-20073372 AAAGAGACATTATTCTGAGTGGG - Intergenic
1053282045 9:36826789-36826811 AAAGGGAAACGATCCTGAGTGGG - Intergenic
1055158113 9:73089638-73089660 AAAGGGAGATTATCCTAGGTAGG + Intergenic
1055164614 9:73176118-73176140 AAAGAGAGACTTTACTGAGAGGG - Intergenic
1056218650 9:84429632-84429654 AAAGAGTGATTATCCTGGTTGGG - Intergenic
1056749345 9:89335624-89335646 AAAAAAAGACTATCCTGGCCAGG - Intronic
1058338968 9:103870377-103870399 AAAGAGACAGTGTCTTGGGTTGG - Intergenic
1058627335 9:106948571-106948593 GAATAGAGATTATTCTGGGTAGG - Intronic
1058677591 9:107413659-107413681 AAAGGCAGATTATCCTGGGTGGG + Intergenic
1058852791 9:109028636-109028658 AAAAAGAGATTATGCTGGGTGGG + Intronic
1059585905 9:115606016-115606038 ATAGGGAGATTATCCTGGGTAGG + Intergenic
1185885583 X:3779574-3779596 AAAAGGAGATTATTCTGGGTAGG + Intergenic
1186744771 X:12556302-12556324 AAATGGAGATTATCTTGGGTGGG + Intronic
1186893342 X:13981860-13981882 AAAGAGAGATAATCCTGGGAGGG + Intergenic
1186996729 X:15131515-15131537 AAAGAGAGATGATCTTGGGTGGG - Intergenic
1187017167 X:15341252-15341274 AAAGAGAGAGCATCCTGAATGGG - Intergenic
1187084076 X:16023566-16023588 AAAGGGAGATTATCCTGGGTGGG + Intergenic
1187090572 X:16091897-16091919 AAAGGCAGACAATCTTGGGTTGG - Intergenic
1187500376 X:19833719-19833741 AAAGAGAGAAGACCCTGGGAAGG - Intronic
1188115987 X:26243493-26243515 AAAGAGAGACTCAGCTGGCTGGG + Intergenic
1188324292 X:28781516-28781538 AAAGGGAAATTATCCTGGTTGGG - Intronic
1188359378 X:29233775-29233797 AAAGGAAGATTATTCTGGGTGGG + Intronic
1189259479 X:39668265-39668287 AAAGTGAGATCATCGTGGGTGGG + Intergenic
1189364497 X:40377857-40377879 AAAGGGAGATTATCCTGGGTGGG + Intergenic
1189537447 X:41950294-41950316 AAAGGGAGATTATCCTTAGTGGG + Intergenic
1189869339 X:45366161-45366183 AAACAGATATTATCCTGGGTGGG + Intergenic
1189968995 X:46399091-46399113 AAAGGGAGATTATCTTGGGTGGG - Intergenic
1190665630 X:52693819-52693841 ACAAAGAGAATCTCCTGGGTGGG - Intronic
1190673788 X:52764591-52764613 ACAAAGAGAATCTCCTGGGTGGG + Intronic
1192868605 X:75163343-75163365 AAAAAGAGATTATCTTGGGTGGG - Intergenic
1193450576 X:81659783-81659805 AAAGGGAGACTATCCTGGGTAGG - Intergenic
1193868148 X:86762440-86762462 AAAGAGAGAATATGGTGGGGTGG - Intronic
1194354927 X:92870973-92870995 AAAGGGAGACTATACTGGGTGGG + Intergenic
1194649616 X:96499467-96499489 AAGGAGTGACTATGCTGGCTGGG + Intergenic
1194939434 X:99992046-99992068 ATGGAGAAACTATTCTGGGTGGG - Intergenic
1195067396 X:101250187-101250209 AAAGAGAGAATATCAGGGGGAGG - Intronic
1195525330 X:105882442-105882464 AAAGAGAGATTATCTTTGGTTGG - Intronic
1195539580 X:106047348-106047370 AAAGAATGACTATCCTGGAGAGG - Intergenic
1195736806 X:108019933-108019955 CAGGAGAGACTCTCCTGTGTGGG - Intergenic
1197944019 X:131818945-131818967 AAAGGGAGATTACCCTGGGGGGG - Intergenic
1198170271 X:134098390-134098412 AGAGAGTTACTATGCTGGGTGGG + Intergenic
1198597443 X:138251988-138252010 AAAGAGAAATTATTCTGGGTGGG - Intergenic
1198843823 X:140887993-140888015 AAAGGGAGATTTTCCTGGGTGGG + Intergenic
1199229378 X:145418402-145418424 AAAGTGAGATTCTCATGGGTGGG - Intergenic
1199545834 X:149006658-149006680 ACACAGAGATTATTCTGGGTGGG - Intergenic
1199574764 X:149302872-149302894 TAAGGGAGATTATCTTGGGTGGG + Intergenic
1199725664 X:150578088-150578110 AAAGAGAAGTTATCCTGGGTAGG + Intronic
1200663287 Y:5987990-5988012 AAAGGGAGACTATACTGGGTGGG + Intergenic