ID: 956409001

View in Genome Browser
Species Human (GRCh38)
Location 3:68959308-68959330
Sequence GTGGGGGCTTAAGAAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956409001_956409004 -6 Left 956409001 3:68959308-68959330 CCAGCAGCTTCTTAAGCCCCCAC No data
Right 956409004 3:68959325-68959347 CCCCACATCTTTTTTTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956409001 Original CRISPR GTGGGGGCTTAAGAAGCTGC TGG (reversed) Intergenic
No off target data available for this crispr