ID: 956409600

View in Genome Browser
Species Human (GRCh38)
Location 3:68965837-68965859
Sequence CTCTGGACAAGTTTGCTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956409600_956409603 0 Left 956409600 3:68965837-68965859 CCACTGAGCAAACTTGTCCAGAG No data
Right 956409603 3:68965860-68965882 CCCCTAGTAACATTAAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956409600 Original CRISPR CTCTGGACAAGTTTGCTCAG TGG (reversed) Intergenic
No off target data available for this crispr