ID: 956410909

View in Genome Browser
Species Human (GRCh38)
Location 3:68978427-68978449
Sequence CAGTTGTACCTAAGGACACA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956410905_956410909 19 Left 956410905 3:68978385-68978407 CCTCTCAGCCTGGCCAAGTCTAA 0: 1
1: 0
2: 3
3: 45
4: 593
Right 956410909 3:68978427-68978449 CAGTTGTACCTAAGGACACAAGG 0: 1
1: 0
2: 2
3: 5
4: 115
956410906_956410909 11 Left 956410906 3:68978393-68978415 CCTGGCCAAGTCTAAGTAACAGC 0: 1
1: 0
2: 0
3: 6
4: 76
Right 956410909 3:68978427-68978449 CAGTTGTACCTAAGGACACAAGG 0: 1
1: 0
2: 2
3: 5
4: 115
956410907_956410909 6 Left 956410907 3:68978398-68978420 CCAAGTCTAAGTAACAGCGTTCA 0: 1
1: 0
2: 1
3: 2
4: 41
Right 956410909 3:68978427-68978449 CAGTTGTACCTAAGGACACAAGG 0: 1
1: 0
2: 2
3: 5
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956410909 Original CRISPR CAGTTGTACCTAAGGACACA AGG Exonic
900748357 1:4376958-4376980 CAGCTGAACCTCAGGGCACATGG - Intergenic
900772573 1:4557140-4557162 CACTTGTAAGTAAGAACACATGG + Intergenic
910271824 1:85403899-85403921 CATTTGTAAGTAAGCACACAGGG - Intronic
913419224 1:118646193-118646215 CAGTTGTATTTCAGGACTCAGGG + Intergenic
916294756 1:163205582-163205604 GAGTGGTACCTAATGAAACAGGG + Intronic
916991886 1:170253448-170253470 CATGTGCACCTAAGAACACATGG - Intergenic
919930489 1:202218172-202218194 CAAAGTTACCTAAGGACACATGG - Intronic
921115327 1:212084848-212084870 CAGTTGTCCCTCAGGATCCATGG + Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921874700 1:220181371-220181393 CAGTTGTCCCTCAGCACCCATGG - Intronic
922405199 1:225305485-225305507 CAGTGGTACCTGAGGAGGCACGG + Intronic
923345367 1:233046497-233046519 CAGTTGTAGTTGGGGACACAGGG - Intronic
1065905967 10:30252252-30252274 AAGTTTTACCTAGGAACACAAGG - Intergenic
1066746137 10:38605062-38605084 CAGTGGTACCCACGGTCACACGG + Intergenic
1067899175 10:50220299-50220321 GAATTGTATCTAAAGACACATGG + Intronic
1068490936 10:57722924-57722946 CAGTGGGTCCTAAGGACTCAAGG - Intergenic
1074665024 10:115712375-115712397 CAGTGGTATCTAAGGAAAGAAGG + Intronic
1075088384 10:119429147-119429169 CAGTGCTTCCTCAGGACACAGGG - Intronic
1076089323 10:127667678-127667700 CAGTTAAAAATAAGGACACAAGG + Intergenic
1089101409 11:115965728-115965750 CAGTTCTACCTACTGACACTGGG - Intergenic
1094569910 12:31632522-31632544 CAGGTGTACGTAAAGCCACAGGG - Intergenic
1098196637 12:68008942-68008964 CAGTTGTACATAAAATCACATGG - Intergenic
1099353533 12:81604977-81604999 TAATTGTTCCTAAGGGCACAAGG - Intronic
1100030528 12:90184238-90184260 AAGTTGTATCTAAAAACACAAGG - Intergenic
1104011994 12:124937773-124937795 CAGTTGTATCTAAATAAACATGG - Intergenic
1106572454 13:30939316-30939338 TAGATGTACCTATAGACACACGG - Intronic
1109015172 13:57000732-57000754 CACTTGTAAGTAAGAACACACGG + Intergenic
1109173643 13:59127466-59127488 CAGTTGGATCAAAGTACACATGG - Intergenic
1121497478 14:94404218-94404240 CAGCTGTACAGAAGCACACATGG + Intergenic
1121551089 14:94801224-94801246 CAGTTGTTCCTAAGGGAACTGGG + Intergenic
1122098777 14:99390831-99390853 CAGTTGCAGCAAAGGAAACAGGG + Intergenic
1125744579 15:41989674-41989696 CAGTTCCCCCAAAGGACACATGG + Intronic
1127836644 15:62795933-62795955 CAGCTTTGCCTAAGGTCACAGGG + Intronic
1128302604 15:66576013-66576035 CAGGTGTACATAAGGACACAGGG - Intergenic
1128565661 15:68699209-68699231 CAGTTGGACCCAAGGAGAGAAGG + Intronic
1131638507 15:94263572-94263594 CTGGTGTTCCTAAGGACAGAAGG - Intronic
1139002500 16:62529937-62529959 CAGTTCTGCCAATGGACACATGG + Intergenic
1139476202 16:67203662-67203684 CAGTTCTACCTGTGGACAGATGG + Exonic
1141455038 16:84135823-84135845 CAGCTGTGCCTGAGGACGCATGG - Intronic
1143677788 17:8448916-8448938 CAGTTGTCCCTCAGTATACATGG - Intronic
1144628548 17:16857904-16857926 CAATTGTACCTGAGGACCTAAGG - Intergenic
1144654745 17:17028478-17028500 CAATTGTACCTGAGGACCCAAGG + Intergenic
1145160136 17:20568475-20568497 CAATTGTACCTGAGGACCTAAGG - Intergenic
1154439616 18:14376678-14376700 CAGTAATACCTGAGGACCCATGG - Intergenic
1157504701 18:48218165-48218187 CACATGTACCCAAGGCCACAAGG - Intronic
1158146699 18:54322548-54322570 CAGTGGAACCTGATGACACAGGG + Intergenic
1158858561 18:61569508-61569530 CTGTTGTACCTGAGGACCCAGGG - Intergenic
1159601082 18:70429465-70429487 CATTTGTCCCTGAGGACACCAGG - Intergenic
1160807427 19:998620-998642 CAGTGGTCCCTGAGGACACCAGG + Intergenic
1163399234 19:17082036-17082058 CAGTTGGTCCTAAGGTCACTTGG - Intronic
1167051376 19:47080971-47080993 CAGTTGTACTTAGGGCAACATGG - Intronic
925545103 2:5007236-5007258 CAGAAGTGCCTAAGGAAACATGG + Intergenic
926079473 2:9972791-9972813 CTGGTGAACCTAAGGACACTTGG - Intronic
927317896 2:21706881-21706903 CTTTTTTACCTAAGGACAAATGG - Intergenic
927973484 2:27320789-27320811 CAGTAGTTCCTAAGGTCCCATGG - Intronic
928446031 2:31333978-31334000 CCTTGGTACCTAAGCACACAAGG + Intergenic
929456159 2:42067504-42067526 CAGTGGTGCCTAAGGCCACCTGG + Intergenic
930881604 2:56276932-56276954 CAGTGCTAACTAAGGACACTAGG + Intronic
934607689 2:95709688-95709710 TATTTGTTCCTGAGGACACAGGG - Intergenic
936475357 2:112834927-112834949 CAGTTGTAGCTAAGGGCATTTGG - Intronic
937213392 2:120293283-120293305 CAGCTGCTCCTAAGGACACAGGG + Exonic
938853879 2:135290059-135290081 CAGTTGTACCCTAGAACAAATGG - Intronic
939436714 2:142186201-142186223 CAGTTGTACCTAGGGACTCATGG + Intergenic
944194097 2:197034221-197034243 CAGTTATAGCTAAGAATACATGG + Intronic
944677525 2:202046794-202046816 CTTTTATACCTAAGAACACAAGG - Intergenic
945259183 2:207828559-207828581 CAGCTGCACCTGAGGCCACAGGG - Intronic
1170246008 20:14222400-14222422 CACTTATAAGTAAGGACACAAGG - Intronic
1170494903 20:16915116-16915138 CAGCTGTACCTCAGGAGGCAGGG - Intergenic
1173848543 20:46203120-46203142 CAGCTGTTCCTAAGGCCATAGGG + Intronic
1174026009 20:47576050-47576072 CAGTTGTACCTACTGCCAAATGG + Intronic
1179086389 21:38221529-38221551 GAGATGTTCCTGAGGACACAGGG + Intronic
1179876989 21:44273588-44273610 CAGGTGAACCAATGGACACACGG + Intergenic
950386543 3:12664466-12664488 CAGACGTGCCTCAGGACACAGGG + Intergenic
950975886 3:17244426-17244448 AAGGTGAAACTAAGGACACAGGG - Intronic
954018042 3:47712790-47712812 TAGTTTTACCCAAGGACACATGG - Intronic
955262213 3:57404128-57404150 CACATGTACCCAAGGAGACACGG + Intronic
956410909 3:68978427-68978449 CAGTTGTACCTAAGGACACAAGG + Exonic
957127140 3:76176072-76176094 CATGTGTCCCAAAGGACACATGG - Intronic
958058242 3:88441651-88441673 CAATTCTACCTAACTACACAAGG - Intergenic
960049405 3:113225768-113225790 CAGTTAGACCTAAGAAGACAGGG - Intronic
960132521 3:114072419-114072441 CAGTTCTACAGAATGACACATGG - Intronic
961756451 3:129130020-129130042 CAGTGGTACCTCAGGACCCAGGG - Exonic
965971876 3:174568758-174568780 CAATTGTACCTAAGGTTATATGG - Intronic
966014425 3:175123629-175123651 CAGTTTAAGCTAAGAACACATGG - Intronic
970775226 4:19666772-19666794 CATTTATACCAAAGGAAACAAGG - Intergenic
974338016 4:60576574-60576596 CAGTTGTCCCTTTGTACACATGG - Intergenic
975428502 4:74259123-74259145 AAGTTGCAGCTAAGAACACAAGG + Intronic
986606180 5:9525484-9525506 CAGTTCAAGCTAAGGACAGAAGG + Intronic
988098176 5:26644785-26644807 CAATTCCACCTAAGGGCACAAGG + Intergenic
988716405 5:33833094-33833116 CATTTTTTCCTAAGAACACATGG + Intronic
992459677 5:76948853-76948875 CACTTATAACTGAGGACACACGG - Intergenic
993193413 5:84707233-84707255 CAGCAGTCCCTAGGGACACATGG + Intergenic
999295520 5:150457396-150457418 CCGTTATAACTGAGGACACAAGG + Intergenic
1000920905 5:167135933-167135955 CAGTAGTACCTAGGTACATAAGG + Intergenic
1005654394 6:27919132-27919154 TAACAGTACCTAAGGACACATGG + Intergenic
1005955633 6:30661501-30661523 CAGTTGTCCCACAGGACACCAGG - Intronic
1008977541 6:57445591-57445613 CTGAGGTAGCTAAGGACACAGGG - Intronic
1010141756 6:72621640-72621662 CAGTTTCTCCTCAGGACACAAGG + Intergenic
1012089946 6:94878996-94879018 CAAATATACCTAAGCACACAAGG + Intergenic
1017019313 6:150127641-150127663 CAGTAGCACCTGGGGACACAGGG - Intergenic
1017693951 6:156995163-156995185 CAGGTGTACCTGAAGACAGACGG + Intronic
1021134901 7:16953688-16953710 CTGCTATACATAAGGACACATGG - Intergenic
1022035287 7:26528187-26528209 CATTTGTCCCTAAAGACATAAGG - Intergenic
1033938627 7:146622034-146622056 CAGGTGTGTCAAAGGACACAGGG - Intronic
1038077070 8:24088335-24088357 CAGTTGCACCAAAGACCACATGG + Intergenic
1038260634 8:25990646-25990668 AAGTTGTATCTAAGAAGACATGG - Intronic
1039334520 8:36574787-36574809 TAGTAGTACCTCAGGCCACATGG + Intergenic
1042647104 8:70998939-70998961 ATGTGGAACCTAAGGACACAGGG - Intergenic
1044337949 8:91011145-91011167 CATTTGTATCTAGGGACAAATGG - Intronic
1050383830 9:5062294-5062316 CAGTTGTCCCTCAGAATACAAGG - Intronic
1051659428 9:19411542-19411564 AAGTAGTACGTAAGAACACAGGG - Intronic
1052999091 9:34567592-34567614 CAGTTATGCCCAGGGACACAGGG + Intronic
1055112938 9:72577347-72577369 CTGTTGTGCCTCAGCACACAGGG + Intronic
1056508652 9:87281766-87281788 CAGTTGCACCTCATGACACCTGG + Intergenic
1059033647 9:110729742-110729764 CAGTTATTTCAAAGGACACAAGG - Intronic
1059362906 9:113759776-113759798 CAGAGGAACCTAAGGAGACATGG + Intergenic
1189763813 X:44348694-44348716 CAGTTGTCCCTCAGTATACACGG - Intergenic
1195422516 X:104691399-104691421 CATTTATACCTCAGGACATATGG + Intronic
1195906900 X:109852924-109852946 CAGGTCCACCTAAGGACATAAGG + Intergenic
1195957340 X:110345539-110345561 TAGTAATACCTGAGGACACATGG + Intronic
1196692948 X:118580278-118580300 CAGTTGTATCTTGGGACACTTGG + Intronic
1199750620 X:150814060-150814082 CAGTTTTACACAATGACACATGG + Intronic
1200835805 Y:7729977-7729999 CAGGTGTCCCTGAGGACACGGGG - Intergenic