ID: 956414963

View in Genome Browser
Species Human (GRCh38)
Location 3:69015770-69015792
Sequence TAAAATAGCACCACATAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956414963_956414964 -3 Left 956414963 3:69015770-69015792 CCTGGCTATGTGGTGCTATTTTA 0: 1
1: 0
2: 1
3: 13
4: 192
Right 956414964 3:69015790-69015812 TTAAACACCTACATATTGAATGG 0: 1
1: 1
2: 1
3: 23
4: 245
956414963_956414966 14 Left 956414963 3:69015770-69015792 CCTGGCTATGTGGTGCTATTTTA 0: 1
1: 0
2: 1
3: 13
4: 192
Right 956414966 3:69015807-69015829 GAATGGTCATTCAGACTTACAGG 0: 1
1: 0
2: 1
3: 7
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956414963 Original CRISPR TAAAATAGCACCACATAGCC AGG (reversed) Intergenic
902899583 1:19505384-19505406 TAAAATAACTCCAGATCGCCTGG - Intergenic
905411834 1:37775747-37775769 TAAAAAACTTCCACATAGCCAGG + Intergenic
907315185 1:53565416-53565438 TAAAATAGAACCAAAAAGACAGG + Intronic
908539921 1:65112482-65112504 AAAACTACCAGCACATAGCCAGG - Intergenic
908720355 1:67118935-67118957 TACAACAGCACACCATAGCCTGG - Intronic
909112496 1:71496725-71496747 TAAAATCACACTACAGAGCCTGG + Intronic
914253219 1:145939189-145939211 TAAAATAGCACAGTACAGCCTGG - Intronic
916133081 1:161628798-161628820 TACAATCTTACCACATAGCCTGG - Intronic
917017277 1:170546978-170547000 GAAAATAGCAGCACATGGCCAGG - Intronic
917762439 1:178176942-178176964 TGAAATTGCACCTGATAGCCAGG - Intronic
918884858 1:190179258-190179280 TAAAATAGAAACACCTTGCCAGG + Intronic
919247268 1:195004435-195004457 TGAAATCGCACCACTCAGCCTGG + Intergenic
919495906 1:198267737-198267759 TAAAATAGCAACACACAGGCTGG - Intronic
919726265 1:200886621-200886643 TAAAATAGCACCTGACAGACCGG - Intergenic
920907174 1:210182284-210182306 TAAAATACCACCTTATGGCCAGG + Intergenic
921292144 1:213668490-213668512 TAAAATGGAACAACAAAGCCTGG - Intergenic
923402241 1:233626283-233626305 TAAAGAAGAACCACATTGCCAGG - Intronic
924059124 1:240153658-240153680 TAAAATAGCATCATACAGGCTGG - Intronic
924800401 1:247325788-247325810 TAAAACACCACCTCCTAGCCAGG - Intronic
1064294493 10:14066117-14066139 TATAATAGCAGCACATAGAAGGG + Intronic
1064425128 10:15223600-15223622 AAAAATAGCTCCACATTGGCTGG + Intronic
1066175610 10:32901843-32901865 TGAAATAGCACCAGATAACGGGG - Intronic
1069392330 10:67949729-67949751 TAAAAAAGCATCACATAGCTGGG + Intronic
1072280957 10:93864939-93864961 CAAAATAGCATCACATGGCTAGG + Intergenic
1072649917 10:97287106-97287128 AAAAATAAAAACACATAGCCAGG - Intronic
1073489268 10:103841827-103841849 TAAAATAGCACAGCAAGGCCGGG + Intronic
1076447996 10:130531608-130531630 TAAAATAGCAGTAAATAGGCCGG + Intergenic
1079940287 11:26672029-26672051 TAAAATTGGAAAACATAGCCAGG - Intronic
1081335653 11:41862785-41862807 TAAAATAGTGCCACATAGAAAGG + Intergenic
1081809895 11:45908828-45908850 GAACATAGCATCACATATCCAGG - Intergenic
1082217628 11:49593579-49593601 TAAAATAGAACCACAATGGCTGG - Intergenic
1086631948 11:89030571-89030593 TAAAATAGAACCACAATGGCTGG + Intronic
1088367806 11:109057465-109057487 TAAACTAGCACTAATTAGCCAGG - Intergenic
1089140907 11:116283197-116283219 TAAAACAGCAGCCAATAGCCAGG - Intergenic
1090456706 11:126856228-126856250 TAAAATACAAACACATAACCAGG + Intronic
1092736267 12:11585809-11585831 TAAAATACAAACACTTAGCCAGG + Intergenic
1093789595 12:23232965-23232987 TAAAATAACATCAAATTGCCTGG - Intergenic
1095708881 12:45267492-45267514 TAAAATAGCACTTACTAGCCAGG + Intronic
1098902166 12:76123915-76123937 TAAAATGCCACCATCTAGCCAGG - Intergenic
1100224675 12:92544228-92544250 TATCATAGCACCATAAAGCCAGG + Intergenic
1102194787 12:111017368-111017390 TAACATGGCACAATATAGCCTGG - Intergenic
1102562584 12:113772975-113772997 AGAAATAGCATCACATGGCCGGG + Intergenic
1106296097 13:28415181-28415203 AATAATAGCACCACTTTGCCCGG + Intronic
1109342646 13:61080621-61080643 TCAAATAGCTCCTCATTGCCCGG - Intergenic
1109883688 13:68513809-68513831 TAAAATAGCTCTAAATTGCCTGG + Intergenic
1111442396 13:88296905-88296927 AAAAAAAGCACCACATAGCTGGG + Intergenic
1114145413 14:19970692-19970714 TAAAATATCAGCACCTACCCAGG - Intergenic
1114321460 14:21550215-21550237 AAAAAAAGCATCACATGGCCAGG - Intergenic
1114366409 14:22032064-22032086 TAAAATAAGACCAAATAGGCAGG + Intergenic
1116529623 14:45953458-45953480 TAAGCCAGAACCACATAGCCAGG - Intergenic
1117620624 14:57582495-57582517 TAAAATGGCCCCTCAGAGCCAGG - Intronic
1120509593 14:85397292-85397314 TGAAATAGCACCACATAGAAAGG + Intergenic
1124642609 15:31405513-31405535 TACAATAGAATCACACAGCCAGG - Intronic
1125058895 15:35395176-35395198 GAAATTAGCACCAAATTGCCAGG - Intronic
1127640331 15:60910051-60910073 TAGAATGGCTCCACACAGCCAGG - Intronic
1131009044 15:89002316-89002338 AAAAATAGAACTAGATAGCCAGG - Intergenic
1131704763 15:94981517-94981539 TAAACTGGCAATACATAGCCTGG - Intergenic
1135285163 16:21187073-21187095 TAAAATAGCCCCCCGCAGCCAGG - Intergenic
1136112989 16:28076578-28076600 GTAAATAGCATCACAGAGCCGGG + Intergenic
1136535862 16:30899048-30899070 TTGACTAACACCACATAGCCTGG + Intronic
1139427938 16:66894744-66894766 AAAAAGAACACTACATAGCCAGG + Intronic
1141964978 16:87435762-87435784 TAAAATAGCACCTCACAGGAAGG + Intronic
1143293062 17:5847491-5847513 TGAAAAAGCACCAAATAGGCAGG - Intronic
1146131653 17:30282188-30282210 TTAAAAAGCAAAACATAGCCAGG - Intronic
1148519379 17:48256066-48256088 TAAAATAGCCACACTTAGCATGG + Intronic
1150697245 17:67416510-67416532 TAAAATAGCAATACATGGGCTGG - Intronic
1155531484 18:26771435-26771457 TCAAATGGCAGCACATAGCCTGG - Intergenic
1156296577 18:35797298-35797320 TAAAAGATCACCACCTTGCCGGG - Intergenic
1160463454 18:79056623-79056645 TAAAAGAAACCCACATAGCCAGG - Intergenic
1161167010 19:2793394-2793416 AGAAATGGCACCACATGGCCGGG + Intronic
1162680678 19:12338536-12338558 TAAAATAGCTCCATCAAGCCGGG - Intergenic
1164517851 19:28951140-28951162 TAAAATAAAACTTCATAGCCTGG - Intergenic
1165163068 19:33829639-33829661 TAAAATACCACAAAATGGCCAGG + Intergenic
1167475747 19:49700084-49700106 AAAAATAACAACAAATAGCCGGG + Intronic
1167528134 19:49998189-49998211 TAAAATAACACTAAATGGCCAGG + Intronic
928981685 2:37142426-37142448 TAAAATAGCAAAACTCAGCCGGG - Intronic
931028824 2:58146836-58146858 TAAAATACAACCACATTGACAGG - Intronic
931034566 2:58224691-58224713 TAAACTAACAACACATAGACAGG + Intronic
932052380 2:68411474-68411496 TAAAATAGCAACAGTGAGCCAGG + Intergenic
935760017 2:106311889-106311911 TAAAAGAGCACTTCATGGCCGGG + Intergenic
936374650 2:111930196-111930218 TTAAAAAGCCCCACATGGCCAGG - Intronic
938581154 2:132647624-132647646 TAAAATAGCCACATATGGCCGGG - Intronic
940515031 2:154673055-154673077 TAAAGCAGCACCACATGGCCAGG - Intergenic
942306836 2:174616854-174616876 CAAAATAGCAATACAAAGCCAGG - Intronic
943802959 2:192085423-192085445 TCAAACAGCACCACATAGTCGGG + Intronic
944079531 2:195771177-195771199 TAAAATAGAATAAAATAGCCAGG + Intronic
945172217 2:207008554-207008576 CAAAATAAAACCACACAGCCAGG - Intergenic
945820093 2:214653656-214653678 TAAAATACTTCAACATAGCCTGG + Intergenic
948791488 2:240380013-240380035 AAAAATAGCACAAAATAGTCTGG + Intergenic
1170642879 20:18171514-18171536 TCAAACAGCATCACATGGCCAGG + Intronic
1171320006 20:24234328-24234350 TAAAATAGCAACACATGGCCTGG + Intergenic
1171859875 20:30388120-30388142 CAAAATAGCAACATACAGCCAGG - Intronic
1173391473 20:42638575-42638597 TAAAAAAGCACAGCATAGTCAGG - Intronic
1174061916 20:47839084-47839106 AAAAACAGGACCACATTGCCAGG - Intergenic
1174069592 20:47890147-47890169 AAAAACAGGACCACATTGCCAGG + Intergenic
1174486307 20:50863552-50863574 GAAAATAGCACCAACTAGGCCGG - Intronic
1176811970 21:13550036-13550058 TAAAATATCAGCACCTACCCAGG + Intergenic
1176881181 21:14195894-14195916 TAATATACCACTACATACCCAGG + Intronic
1178352887 21:31885501-31885523 TAAGACAGCACCACAGACCCGGG + Intronic
1178505767 21:33161761-33161783 TAAAATTACACCAATTAGCCAGG - Intergenic
1180297027 22:10950489-10950511 CAAAATAGCAACATACAGCCAGG + Intergenic
1181561347 22:23703630-23703652 TAAAAAAGCAAAACTTAGCCGGG + Intergenic
1182742857 22:32581405-32581427 TAAAATAGCCCCAGTTGGCCGGG - Intronic
1183207389 22:36428887-36428909 TAGAAAAGCAACACATTGCCGGG + Intergenic
1183875641 22:40778118-40778140 TTCAATAGTACCACATTGCCAGG - Intronic
1184511384 22:44935317-44935339 TAAAACAGAAGCACATGGCCGGG + Intronic
955966762 3:64396873-64396895 TAATATAGGACCAAATATCCGGG + Intronic
956171983 3:66440186-66440208 TAAAAAACCACCACAACGCCTGG + Intronic
956369529 3:68543343-68543365 TAAAATAGCAGAACATAATCTGG + Intronic
956414963 3:69015770-69015792 TAAAATAGCACCACATAGCCAGG - Intergenic
960642457 3:119839875-119839897 TAATATACCCCCACATACCCTGG - Intronic
965909195 3:173750261-173750283 TAAAATACAGTCACATAGCCTGG - Intronic
968247432 3:197166592-197166614 TAAAACAACACAACATGGCCGGG + Intronic
968387299 4:152747-152769 TAAAATATCACATCACAGCCAGG - Intronic
969319394 4:6402653-6402675 TAAACAAGCACCACATGGCATGG + Intronic
969343967 4:6559863-6559885 TAACAAAACACCATATAGCCTGG - Intronic
970426472 4:15950614-15950636 TAAATTAGCAACATATTGCCAGG - Intergenic
970873923 4:20847764-20847786 GAAAGTAGCTCAACATAGCCAGG - Intronic
972619540 4:40733626-40733648 TAAAATAGAACCAGAAAGTCTGG + Intergenic
974753473 4:66171725-66171747 TAAAATAGCACGAGAAAGACTGG + Intergenic
976523577 4:86059278-86059300 TAAAATAGCTTAATATAGCCAGG + Intronic
979243314 4:118469534-118469556 TAAAATAGCATCTGTTAGCCAGG + Intergenic
979694913 4:123602392-123602414 TAAGATAGCACAACAGAGGCCGG + Intergenic
980914214 4:139019348-139019370 TAAAAAAGCACTTCATAGGCTGG - Intronic
981047681 4:140280422-140280444 TAAAAAATCACAACATGGCCAGG - Intronic
981277811 4:142922304-142922326 TAAGATGGCATCACACAGCCAGG + Intergenic
982543291 4:156702690-156702712 TAAAATTGCACCACAAAGAGAGG + Intergenic
984462275 4:180053421-180053443 TAAAATATCACCACATATAAAGG + Intergenic
985287767 4:188354438-188354460 TTAAACAGCACCACATAGGTGGG - Intergenic
985438037 4:189951823-189951845 TAAAATAGCAACATACAGCCAGG - Intronic
986181294 5:5395130-5395152 TAAAAATGCACCAATTAGCCGGG + Intergenic
987317678 5:16739024-16739046 TTAAAAAGCAACACAGAGCCAGG + Intronic
990170192 5:53039250-53039272 CAAAATAGCACCTTATAGCAAGG - Intronic
990960475 5:61388276-61388298 TTAAAAAGCAGCACTTAGCCAGG - Intronic
995801486 5:116001038-116001060 TAAAAAATCACCACAAAGGCAGG - Intronic
995805400 5:116046714-116046736 TGAAATAACCCAACATAGCCAGG - Intronic
996258842 5:121440499-121440521 TGAAACAGCACCAAATAGACAGG + Intergenic
999131593 5:149287875-149287897 AAAAATAGGACCTCATGGCCGGG - Intronic
999144545 5:149383631-149383653 TAAAATAGCACCTCTTGGCTGGG - Intronic
999932468 5:156448549-156448571 TTAAATAGCCTCACATTGCCTGG + Intronic
1000699935 5:164436475-164436497 TAAAATAGCTCACCACAGCCTGG + Intergenic
1003088267 6:3079071-3079093 AAAAATACCACCACACAGCTGGG - Intronic
1003174884 6:3747036-3747058 TACATTAGCACCACATGGGCTGG + Intronic
1004393946 6:15231989-15232011 AAAATTAGCCCCACATGGCCGGG - Intergenic
1004611853 6:17248897-17248919 AGAAATAGAACCACATAGGCTGG - Intergenic
1005411008 6:25546752-25546774 TAAAATAGTAACAGAGAGCCTGG + Intronic
1006005559 6:30999207-30999229 TAAATTGGTACCACATATCCAGG - Intergenic
1006279703 6:33040729-33040751 TTAAAAAGAACCAAATAGCCTGG - Intergenic
1007058616 6:38914644-38914666 TAAAAAAGCAGCACATAGGCCGG - Intronic
1007103227 6:39265474-39265496 TAAAATAACAGCAAAAAGCCAGG - Intergenic
1007238525 6:40408459-40408481 TAGAATAGCATCAGATGGCCAGG - Intronic
1007269814 6:40627892-40627914 TAAAATAGCAAAAATTAGCCAGG + Intergenic
1008018247 6:46545929-46545951 TAAAAAAGAAACACATAGACAGG + Intergenic
1008784618 6:55152036-55152058 TAAAATGGAACAACAGAGCCTGG - Intronic
1015760660 6:136656780-136656802 TAAAATTGCAAAACGTAGCCAGG - Intronic
1017316541 6:153037718-153037740 TAAAATAGCAAAAAATAGGCCGG - Intronic
1017596256 6:156031695-156031717 TAAAATAGTTCCACATTGCCAGG - Intergenic
1021308063 7:19055467-19055489 TTAAATATCAGTACATAGCCAGG - Intronic
1023041615 7:36177872-36177894 TAAAAATGCAAAACATAGCCGGG - Intronic
1025232541 7:57212080-57212102 CAAAACAGGACCACATTGCCAGG + Intergenic
1026487254 7:70832031-70832053 TAAAATACTAATACATAGCCAGG - Intergenic
1026767847 7:73171767-73171789 TAGAATAGAAGCACACAGCCTGG - Intergenic
1027079328 7:75220883-75220905 TAGAATAGAAGCACACAGCCTGG + Intergenic
1028646785 7:93107199-93107221 TAAAATAACACAACAAGGCCAGG - Intronic
1028753344 7:94407638-94407660 TCAGATAGTACCACATATCCAGG - Intronic
1029485634 7:100838281-100838303 TAAAATTGAACCACATGGCTGGG - Intronic
1030349703 7:108469808-108469830 TAAAATAGTACTTCATGGCCAGG - Intergenic
1030563175 7:111116841-111116863 TAAAACAGCACCACACACCTTGG - Intronic
1030803695 7:113887733-113887755 TAAAAAAGCACAAAATGGCCAGG + Intronic
1031608123 7:123793801-123793823 TAAATTAGCACCACAGAGAGTGG + Intergenic
1033848938 7:145470671-145470693 TAAAAATGCAAAACATAGCCGGG + Intergenic
1034163508 7:149009089-149009111 TAAAATTACATAACATAGCCAGG - Intronic
1034972321 7:155427067-155427089 AAAAAAATCACCACAAAGCCAGG - Intergenic
1036531593 8:9594180-9594202 TAAAATAACAGGAGATAGCCGGG - Intronic
1036692838 8:10955666-10955688 GAAAACAGAACCACATAGCTTGG - Intronic
1036934844 8:12991768-12991790 TAAAAATGCACAACTTAGCCAGG + Intronic
1038948115 8:32384074-32384096 TAAAATAGAAAAACATAGCCAGG + Intronic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1044055723 8:87567221-87567243 TAAAATATCAGCAAATGGCCCGG - Intronic
1044799051 8:95934540-95934562 TAAACTAGGAACATATAGCCAGG + Intergenic
1045174051 8:99701013-99701035 TAACTTAGTTCCACATAGCCAGG + Intronic
1049145388 8:140997423-140997445 TCAAATAGCATCACATACTCTGG + Intronic
1051585164 9:18719657-18719679 AAAAAAAGAACCACAAAGCCAGG - Intronic
1053571286 9:39310426-39310448 TATAAAAGCATCACATGGCCGGG - Intergenic
1054092851 9:60869118-60869140 TATAAAAGCATCACATGGCCGGG - Intergenic
1054114324 9:61145030-61145052 TATAAAAGCATCACATGGCCGGG - Intergenic
1054125859 9:61308586-61308608 TATAAAAGCATCACATGGCCGGG + Intergenic
1054593429 9:67037492-67037514 TATAAAAGCATCACATGGCCGGG + Intergenic
1055528866 9:77163188-77163210 TAAAGTGGCACTACAGAGCCTGG + Intergenic
1056460855 9:86808506-86808528 TACAATAGTACCACATAACTAGG - Intergenic
1057539057 9:95947788-95947810 TAAAATGGAACAACAAAGCCTGG + Intronic
1058831185 9:108818328-108818350 CAAAATAGCCACACATGGCCAGG + Intergenic
1059015949 9:110515594-110515616 TAAAATATCCCCACATAGGCCGG - Intronic
1059179034 9:112194416-112194438 TAAAATACAACAACTTAGCCAGG + Intergenic
1187157023 X:16729776-16729798 TAAAATAAAAGCACATAGGCTGG - Intronic
1191026193 X:55916348-55916370 CAAAATAGCAGGACGTAGCCTGG - Intergenic
1191089349 X:56603403-56603425 GAAAATAGCACCAGAAAGACTGG + Intergenic
1191781080 X:64866589-64866611 TAAAAAAACACCACAGTGCCTGG + Intergenic
1192728710 X:73780380-73780402 TTTAATAGCACCAGATAACCTGG - Intergenic
1195293280 X:103449848-103449870 TAATATAGACCAACATAGCCTGG + Intergenic
1196976869 X:121167967-121167989 TAAAATACAAACAAATAGCCGGG - Intergenic
1198135986 X:133750776-133750798 TTTAAAAGCACCACATGGCCAGG + Intronic
1198824940 X:140689563-140689585 TTAAAGAGCAGCAAATAGCCGGG - Intergenic
1199289711 X:146092185-146092207 TAAAATTGAACAACAAAGCCAGG - Intergenic
1200269939 X:154673372-154673394 AACAATAGTACCACATGGCCTGG - Intergenic
1201733655 Y:17233630-17233652 TAAAATATCATCACGTAGCTTGG - Intergenic
1202139326 Y:21704836-21704858 TAAAATAGCACTAAGTGGCCGGG - Intergenic