ID: 956426417

View in Genome Browser
Species Human (GRCh38)
Location 3:69140274-69140296
Sequence CTCTTTCCTTCTTTTTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956426409_956426417 4 Left 956426409 3:69140247-69140269 CCTTCCTTCCTTCCTTCCTTCCT 0: 34948
1: 26069
2: 32679
3: 41950
4: 55755
Right 956426417 3:69140274-69140296 CTCTTTCCTTCTTTTTGTTGGGG No data
956426412_956426417 -8 Left 956426412 3:69140259-69140281 CCTTCCTTCCTTTCTCTCTTTCC No data
Right 956426417 3:69140274-69140296 CTCTTTCCTTCTTTTTGTTGGGG No data
956426403_956426417 28 Left 956426403 3:69140223-69140245 CCTTCCTTCCTTCCTTCCTTCCT 0: 34948
1: 26069
2: 32679
3: 41950
4: 55755
Right 956426417 3:69140274-69140296 CTCTTTCCTTCTTTTTGTTGGGG No data
956426406_956426417 16 Left 956426406 3:69140235-69140257 CCTTCCTTCCTTCCTTCCTTCCT 0: 34948
1: 26069
2: 32679
3: 41950
4: 55755
Right 956426417 3:69140274-69140296 CTCTTTCCTTCTTTTTGTTGGGG No data
956426410_956426417 0 Left 956426410 3:69140251-69140273 CCTTCCTTCCTTCCTTCCTTTCT 0: 1890
1: 39662
2: 32147
3: 41355
4: 56371
Right 956426417 3:69140274-69140296 CTCTTTCCTTCTTTTTGTTGGGG No data
956426411_956426417 -4 Left 956426411 3:69140255-69140277 CCTTCCTTCCTTCCTTTCTCTCT 0: 290
1: 2567
2: 8957
3: 52819
4: 54343
Right 956426417 3:69140274-69140296 CTCTTTCCTTCTTTTTGTTGGGG No data
956426408_956426417 8 Left 956426408 3:69140243-69140265 CCTTCCTTCCTTCCTTCCTTCCT 0: 34948
1: 26069
2: 32679
3: 41950
4: 55755
Right 956426417 3:69140274-69140296 CTCTTTCCTTCTTTTTGTTGGGG No data
956426407_956426417 12 Left 956426407 3:69140239-69140261 CCTTCCTTCCTTCCTTCCTTCCT 0: 34948
1: 26069
2: 32679
3: 41950
4: 55755
Right 956426417 3:69140274-69140296 CTCTTTCCTTCTTTTTGTTGGGG No data
956426404_956426417 24 Left 956426404 3:69140227-69140249 CCTTCCTTCCTTCCTTCCTTCCT 0: 34948
1: 26069
2: 32679
3: 41950
4: 55755
Right 956426417 3:69140274-69140296 CTCTTTCCTTCTTTTTGTTGGGG No data
956426405_956426417 20 Left 956426405 3:69140231-69140253 CCTTCCTTCCTTCCTTCCTTCCT 0: 34948
1: 26069
2: 32679
3: 41950
4: 55755
Right 956426417 3:69140274-69140296 CTCTTTCCTTCTTTTTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956426417 Original CRISPR CTCTTTCCTTCTTTTTGTTG GGG Intergenic
No off target data available for this crispr