ID: 956428769

View in Genome Browser
Species Human (GRCh38)
Location 3:69163875-69163897
Sequence CAGTAGCCCTTCAATTATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956428769_956428771 -1 Left 956428769 3:69163875-69163897 CCATCATAATTGAAGGGCTACTG No data
Right 956428771 3:69163897-69163919 GGAAATGCCCTTCCCAGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956428769 Original CRISPR CAGTAGCCCTTCAATTATGA TGG (reversed) Intergenic
No off target data available for this crispr