ID: 956429614

View in Genome Browser
Species Human (GRCh38)
Location 3:69172604-69172626
Sequence TAATATATTTAGAAGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 296}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956429611_956429614 -9 Left 956429611 3:69172590-69172612 CCTCAGGGACAAAATAATATATT 0: 1
1: 0
2: 0
3: 37
4: 397
Right 956429614 3:69172604-69172626 TAATATATTTAGAAGGTGGCAGG 0: 1
1: 0
2: 3
3: 27
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956429614 Original CRISPR TAATATATTTAGAAGGTGGC AGG Intronic
901791454 1:11655346-11655368 TGAGATCTTGAGAAGGTGGCTGG + Exonic
902007239 1:13242162-13242184 TAAAATATTTGGAGAGTGGCTGG - Intergenic
902026291 1:13386469-13386491 TAAAATATTTGGAGAGTGGCTGG - Intergenic
902547281 1:17197981-17198003 TAATATATGTAAAAGGTGCCTGG - Intergenic
903084700 1:20845364-20845386 TAATATAGTTTGAAGTAGGCTGG + Intronic
903610982 1:24612508-24612530 TAATATATCCAGAATGTGGCCGG - Intergenic
905194252 1:36262370-36262392 TATTATGTTTGGAATGTGGCAGG - Intronic
905624481 1:39478733-39478755 CCATAAATCTAGAAGGTGGCAGG - Intronic
906416955 1:45627405-45627427 AAATATTTTTAGAAGTTGGGGGG - Exonic
906534070 1:46541870-46541892 TAATATATATAAAAGGCGGCCGG - Intergenic
908412438 1:63880375-63880397 TAATATGTTTAGAAGCTGATGGG + Intronic
908904474 1:68992294-68992316 AAACATATGTAGAAAGTGGCTGG + Intergenic
909378030 1:74962490-74962512 TAATTTATTTATTAGTTGGCAGG - Intergenic
910296310 1:85649101-85649123 TAATATATTTTGAAGTTGGGTGG - Intergenic
911664030 1:100534185-100534207 TAAAATATTTAGACATTGGCAGG + Intergenic
911710378 1:101064673-101064695 CAAAATATTAAGAAGGTAGCTGG - Intergenic
913524496 1:119678114-119678136 TCATTTAATTTGAAGGTGGCTGG + Intronic
914684933 1:149969996-149970018 AAATCTATTCAGAAGGGGGCTGG - Intronic
915293423 1:154901927-154901949 TAATATATTTTGATGGGGGGGGG + Intergenic
916078686 1:161218438-161218460 TAAAATATTCAGCAGGTGACAGG + Intronic
916898976 1:169200487-169200509 TATTATCTCTAGAAGATGGCTGG - Intronic
917609418 1:176671429-176671451 CAAAATATCCAGAAGGTGGCTGG + Intronic
917672381 1:177285322-177285344 TAAAAAATTGAGAAGTTGGCTGG + Intergenic
918462516 1:184790995-184791017 TCATTTATTTGGAAGGAGGCTGG - Intronic
919467197 1:197936413-197936435 TAAAATATCCAGAAGGAGGCTGG - Intergenic
919826879 1:201509286-201509308 TAATATAGTCAGAAGGTGAGAGG - Intronic
921227382 1:213033720-213033742 TAAAATATTATGAAGATGGCTGG + Intergenic
921935381 1:220790956-220790978 TAAAATTTTTAAAAGGTGGGGGG + Intronic
922189553 1:223305560-223305582 TCATATATTTAAGAGGTGGGAGG + Intronic
923370665 1:233309243-233309265 TAAAATATTTGGAATATGGCCGG + Intergenic
924059377 1:240155683-240155705 TACTAGATTTAGAAGGTGTGAGG + Intronic
1063658040 10:8011175-8011197 TAATATGATTGGAAAGTGGCTGG + Intronic
1063904630 10:10768966-10768988 TAATATATTTGGCAGGTAGAAGG - Intergenic
1064042640 10:11981635-11981657 TAATATCTTTAGAGAGTGGTGGG - Intronic
1064192659 10:13221173-13221195 TAAAATATGTAGAAGTCGGCTGG + Intergenic
1064727173 10:18292359-18292381 TAATATTGTTTCAAGGTGGCTGG + Intronic
1065417515 10:25504329-25504351 CAATATATTTAGAAAAAGGCAGG - Intronic
1065838372 10:29679724-29679746 AAAGGTATTTAGAAAGTGGCTGG - Intronic
1066072673 10:31835931-31835953 TAATATATTTACAACGTGTGTGG - Intronic
1066264673 10:33764606-33764628 TAATATATGTAAAAGGGGCCAGG - Intergenic
1066584993 10:36923080-36923102 TAAATTATTTAAAAGGTGGTGGG - Intergenic
1067977815 10:51045567-51045589 TAAAATATTTTCAAGGTGGGCGG - Intronic
1070080761 10:73184583-73184605 TAATTTAATTCCAAGGTGGCTGG - Intronic
1070589466 10:77791541-77791563 TAAACTTTTTAGAGGGTGGCAGG - Exonic
1073385531 10:103124650-103124672 TAATTTTTTTAAAAGGTGGGGGG - Intronic
1074332017 10:112522840-112522862 AAATCTATTTACAATGTGGCTGG + Intronic
1074643683 10:115418789-115418811 CAATATATTCAGAATGTGGAAGG + Intronic
1075081746 10:119388765-119388787 TGAGATATTAAGAAGTTGGCTGG + Intronic
1075126612 10:119705414-119705436 AAAAATATTAAGAAGGTGGCTGG - Intergenic
1075699468 10:124459842-124459864 TAATATATTTAGAGGTTGTGGGG + Intergenic
1077430932 11:2515710-2515732 GAGTATATTTAGAAGGCGCCGGG - Intronic
1077738108 11:4813151-4813173 TAATAGATTAACATGGTGGCAGG - Intronic
1079605939 11:22366693-22366715 TTATATTTTAAAAAGGTGGCTGG + Intronic
1079993127 11:27267275-27267297 TAATACATTTAGAAAATGGTAGG + Intergenic
1081059134 11:38450819-38450841 TGATATATTGAAAATGTGGCAGG + Intergenic
1081457771 11:43242187-43242209 TAATTTGTCTAGAAGGTAGCTGG - Intergenic
1081982583 11:47277591-47277613 AAATATATGTAGAAAGAGGCTGG - Intronic
1081994143 11:47352776-47352798 ATCTATATTTAGCAGGTGGCTGG - Intergenic
1083338588 11:61944081-61944103 TAATTTATTTTGAAGGAGGGAGG - Intergenic
1085817207 11:79751981-79752003 TAATATATTTTGAAGTCGGTTGG - Intergenic
1086924276 11:92623645-92623667 TAAAATATTTAAACAGTGGCTGG + Intronic
1087190145 11:95245534-95245556 TGCTATAGTTAGAAGGTCGCAGG - Intergenic
1087654445 11:100905470-100905492 ATATATATTTGGAAGGTAGCAGG - Intronic
1089011425 11:115135315-115135337 GAATTTATTTAAAAGGTGGCCGG + Intergenic
1090870636 11:130743742-130743764 TAAAATATTTATAATGAGGCAGG + Intergenic
1091858181 12:3755743-3755765 TAAGATTTCAAGAAGGTGGCAGG - Intronic
1092701458 12:11235646-11235668 TTATTTATTTAGAAGGTGAGAGG - Intergenic
1093433228 12:19107028-19107050 GATTATATTGTGAAGGTGGCTGG + Intergenic
1094223484 12:28020232-28020254 TAATATACTTAAAAGTTGCCAGG - Intergenic
1094484948 12:30917632-30917654 AAATAGATTTATAATGTGGCTGG + Intergenic
1095259054 12:40077560-40077582 TAATATAGTTTGAAGTTGGTAGG + Intronic
1097077541 12:56406750-56406772 TAAGATATTTAAAAGGGGCCGGG - Intergenic
1100246664 12:92765189-92765211 TTATATATTTAAATGCTGGCCGG + Intronic
1101464310 12:104931993-104932015 TAATATAGTTTGAAAGTGCCAGG + Intronic
1101496102 12:105255764-105255786 TAAAATATTTAAAAGTTAGCTGG + Intronic
1101574113 12:105981548-105981570 TTATAGATTCAGAAGGTGCCAGG - Intergenic
1102003739 12:109575195-109575217 TAAGACATTTAGAAGTTGGAAGG + Intronic
1102064669 12:109964011-109964033 TAATATCTCTAGCACGTGGCAGG - Intronic
1105037483 12:132937060-132937082 GAAAATATATGGAAGGTGGCTGG + Intronic
1106936207 13:34723629-34723651 TAATATTTTTTGAAACTGGCTGG - Intergenic
1107435955 13:40381145-40381167 TAATATATTTTGAACATTGCTGG - Intergenic
1109031362 13:57193876-57193898 TCCTATCTTTAGAAGGTCGCTGG - Intergenic
1109638270 13:65151971-65151993 TAATATATTCAACACGTGGCTGG - Intergenic
1110605924 13:77432514-77432536 AAATATAATTAGTTGGTGGCTGG + Intergenic
1110833441 13:80057616-80057638 TATAATATTTACAAAGTGGCAGG - Intergenic
1111311947 13:86500989-86501011 TAAAACATTTAAAAGGTGGCAGG + Intergenic
1115183293 14:30655291-30655313 TAATATGTTTGGAAAATGGCAGG + Intronic
1115246060 14:31296993-31297015 AAATATATTAAAAAGCTGGCTGG + Intronic
1115833891 14:37375479-37375501 TAATAAATTAAAAAGGAGGCTGG - Intronic
1116330415 14:43589853-43589875 TCATCTATTTAGAATGAGGCAGG - Intergenic
1116429244 14:44827016-44827038 AAATATTTTTAGAAAGAGGCCGG + Intergenic
1117190932 14:53290676-53290698 TAATAATTTTTGAAGGTGGGAGG - Intergenic
1118224349 14:63884934-63884956 TAAAATATTTCAAAGGCGGCCGG - Intronic
1118435023 14:65763230-65763252 TAAAAAATTTTGAATGTGGCTGG - Intergenic
1119279090 14:73388652-73388674 TTTTATAGTTTGAAGGTGGCTGG - Intronic
1119895632 14:78217550-78217572 TAATATTTCTAGAAGGATGCAGG - Intergenic
1121670614 14:95708176-95708198 TAAAATATGTAGAGGGAGGCTGG + Intergenic
1124804569 15:32868640-32868662 TAATACATGTAGATGGAGGCAGG + Intronic
1126970409 15:54104842-54104864 TAAGACACTGAGAAGGTGGCTGG + Intronic
1127364303 15:58272916-58272938 AAATATATTAAGAAAGAGGCTGG - Intronic
1127809054 15:62547578-62547600 TAAAAGACTTTGAAGGTGGCTGG + Intronic
1129373442 15:75112128-75112150 TAAAAAATTTAAAAGGTAGCTGG + Intronic
1130020168 15:80223572-80223594 TTGTATATCTAGAAGGTTGCTGG + Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130419035 15:83723935-83723957 TAAGATATTTTGAAGGTTGGTGG + Intronic
1132271483 15:100530301-100530323 TCCTATAGGTAGAAGGTGGCTGG - Intronic
1132894591 16:2222724-2222746 TAAAAAATTTAAAAAGTGGCTGG + Intergenic
1133319792 16:4905944-4905966 AAATATTTTTAAAAGGTAGCTGG + Intronic
1134619948 16:15680277-15680299 TACTATATTCAGAATGTGGGGGG + Intronic
1140689822 16:77471051-77471073 TAATACCTTTAGAATGTGCCTGG + Intergenic
1141362635 16:83410369-83410391 TAACATTTTTAGAAGATGGAAGG - Intronic
1203140564 16_KI270728v1_random:1762812-1762834 TCAGATATTTAGAAGGTGGCTGG + Intergenic
1142743738 17:1944751-1944773 TAATACATTTTGAAGTTGGCCGG - Intronic
1143145564 17:4772874-4772896 TAAAATATTTAAAAGTTAGCTGG - Intronic
1143230149 17:5347111-5347133 TAATAACTTCACAAGGTGGCTGG + Intronic
1143418701 17:6771641-6771663 GTATACAATTAGAAGGTGGCAGG + Intronic
1145198132 17:20914083-20914105 TAACATACTGAGAATGTGGCCGG - Intergenic
1150191494 17:63245409-63245431 TAAAATATATAAAATGTGGCAGG + Intronic
1150874813 17:68959105-68959127 TATGATATTTAGAAGGGGCCAGG + Intergenic
1151111410 17:71682449-71682471 TAATATATTTATAAAATAGCAGG - Intergenic
1153413042 18:4815409-4815431 TAATATATTTTCAAGTTGTCAGG - Intergenic
1156991348 18:43411853-43411875 TAAAATATTTCCAAGGTGGCTGG + Intergenic
1159894519 18:73983614-73983636 GAATAAATATAGAATGTGGCGGG - Intergenic
1159926421 18:74273632-74273654 GAGTATATTTAGAAAGAGGCAGG - Intronic
1160835104 19:1121183-1121205 TAAAATATTAAGAACCTGGCCGG - Intronic
1161374823 19:3933926-3933948 GAGTATAATTGGAAGGTGGCGGG - Intronic
1161811619 19:6474770-6474792 AAATATATAGAGACGGTGGCCGG + Intronic
1162267226 19:9585418-9585440 TATTATATTGAAAACGTGGCCGG - Intergenic
1164505454 19:28856989-28857011 TATTATCTTTATAAGGTGGACGG - Intergenic
1164619432 19:29685612-29685634 TAAAATATTTAAAAGCTGGCGGG - Intergenic
926464756 2:13174738-13174760 TAATTTATTTAGTAGATAGCAGG + Intergenic
928456263 2:31425636-31425658 TAATAAATAAAGAAGCTGGCTGG + Intergenic
929035265 2:37684908-37684930 AAAAATATTTAGAAGGTTGGAGG + Intronic
929491580 2:42401732-42401754 AAATATTTTTAAAAGGAGGCTGG - Intronic
929657133 2:43745015-43745037 TAATATATATAGAACTAGGCCGG + Intronic
933897991 2:86828173-86828195 TAATAAATGAAGATGGTGGCTGG + Intronic
935352560 2:102165994-102166016 TTATATTTTTAGAAAGTGACTGG - Intronic
935837383 2:107069724-107069746 TAAAATATTTTGCAGGTGGTTGG - Intergenic
936879723 2:117234940-117234962 TAATTTTTTTATAAGGTGTCAGG - Intergenic
939663257 2:144917357-144917379 TAAGAGATTTAGAAGGTGGCTGG + Intergenic
940403185 2:153269802-153269824 TACTTTCTTTACAAGGTGGCAGG + Intergenic
941017192 2:160370606-160370628 CCACACATTTAGAAGGTGGCAGG + Intronic
941111882 2:161425138-161425160 TATTCTATTTAGAAGGTGGGGGG - Exonic
941474146 2:165927478-165927500 TAATATGTTTAGAAAATGACAGG - Intronic
941985812 2:171510729-171510751 TAATATATTACAAAGGGGGCTGG + Intergenic
942716238 2:178895668-178895690 GAAAATATTTGGAAAGTGGCTGG + Intronic
942773327 2:179549380-179549402 TAATATTTTGAGGAAGTGGCAGG + Intronic
942920266 2:181364722-181364744 TAATATACGTGGAAGGTGGAAGG + Intergenic
943192919 2:184704043-184704065 TAATATATTAACATTGTGGCTGG - Intronic
943815490 2:192249241-192249263 GAATATATTTGGAAGGTAGAGGG - Intergenic
945580126 2:211583225-211583247 TATTATTTTTAGAATATGGCTGG - Intronic
946350464 2:219147961-219147983 AAATATATTAAGAAGGTGGCTGG + Intronic
946355087 2:219179482-219179504 TAATTTACTTAGTAGGTGACAGG + Intronic
946846720 2:223865669-223865691 TAATATATGTAGAAGGATGCTGG + Intronic
947167957 2:227281973-227281995 TAAAATATTTCTAAAGTGGCCGG + Intronic
948996728 2:241584320-241584342 TAAGAAATTAAGAAGGGGGCTGG - Intergenic
1170070944 20:12366873-12366895 TAATAAATTTAGAAGCTTGAGGG + Intergenic
1170111852 20:12813074-12813096 TAAGATATTTTGAAGTTGGGTGG - Intergenic
1172382109 20:34503289-34503311 TATTTTAATTAGAAGGGGGCAGG - Intronic
1172812864 20:37662372-37662394 TAATATATTCACAGGGTTGCTGG + Intergenic
1174009186 20:47435628-47435650 TAATATTTTGAGAAGGGGGTGGG + Intergenic
1175077076 20:56384764-56384786 TAATATAAATGGAGGGTGGCTGG - Intronic
1175354930 20:58357315-58357337 TAAAACATTAAGAAGGAGGCAGG - Intronic
1175749453 20:61485236-61485258 TAATATAATTATAGGGTGACAGG + Intronic
1177213564 21:18100279-18100301 TAATAGATGTTGAAGGTGGAAGG + Intronic
1177376807 21:20280752-20280774 TCATATATTTAGAAGTTTGCTGG + Intergenic
1177653803 21:23989989-23990011 TTATATAATTAGCATGTGGCAGG - Intergenic
1180567452 22:16685283-16685305 TAATTTATTTAGATGGAGTCTGG - Intergenic
949314846 3:2741349-2741371 TAATATATTTGGAGGGTGAATGG + Intronic
950403479 3:12788940-12788962 TAATAAATGTAGAAGGTGACTGG + Intergenic
950518511 3:13482477-13482499 TAATATCATCAGAAGGTGGAGGG + Intronic
951475144 3:23097093-23097115 AAAAATATGTAGAAGGTAGCCGG - Intergenic
951982215 3:28577389-28577411 TAATATATTTTGAAACTGGCTGG + Intergenic
952155240 3:30636693-30636715 TTATATATTTAGACGGTCTCTGG - Intronic
952864403 3:37843167-37843189 TAATTTTTTTAGAAGGTGTAAGG - Intergenic
954000365 3:47551961-47551983 TTATATATTTTGAAGCTGTCAGG + Intergenic
954009753 3:47625529-47625551 GAATATATATAGAAGTAGGCTGG - Intronic
954355409 3:50080682-50080704 TAATAAATTCAGACGTTGGCCGG - Intronic
956154153 3:66276262-66276284 TAATACAACTAGGAGGTGGCAGG + Intronic
956342868 3:68246292-68246314 CTATAAATTGAGAAGGTGGCCGG + Intronic
956429614 3:69172604-69172626 TAATATATTTAGAAGGTGGCAGG + Intronic
956599693 3:71007446-71007468 TAATACATGTCGAAGGAGGCCGG - Intronic
957408810 3:79809459-79809481 TACAATATCTAGAAGATGGCAGG - Intergenic
957980439 3:87502609-87502631 AAAAATATTTATGAGGTGGCTGG - Intergenic
958551009 3:95612322-95612344 TAATATATGTGTAAGCTGGCAGG - Intergenic
959632058 3:108517762-108517784 GAATTTAATCAGAAGGTGGCCGG - Intronic
959661970 3:108879075-108879097 TAATAAATATAGAAAGTAGCGGG + Intergenic
960611829 3:119561664-119561686 TAAAAGATTTAAAAGGAGGCTGG + Intergenic
961559967 3:127721960-127721982 TTACATATTTAAAAGGTGGAAGG + Intronic
961965860 3:130902000-130902022 TAAAAAATTTTGAGGGTGGCGGG - Intronic
962620757 3:137175789-137175811 GAATACAATTAGAAGGTGGGTGG + Intergenic
963523515 3:146386720-146386742 TTATATATGTAGAAAGTGGGTGG + Intergenic
965188407 3:165496817-165496839 AAATATATCTAAAATGTGGCAGG + Intergenic
965338465 3:167456995-167457017 TTATATAGTAAGAAAGTGGCAGG + Intronic
966961168 3:184940632-184940654 TAATACATTTAGAGGTGGGCTGG - Intronic
969062690 4:4450598-4450620 TAATAAATACAGAAGGAGGCTGG - Intronic
970409848 4:15794030-15794052 TAATATTTTCAGACTGTGGCTGG - Intronic
970724430 4:19027457-19027479 TAAAACATTTAGAAAGTGCCTGG + Intergenic
970730561 4:19098539-19098561 AAATATATATATAACGTGGCTGG - Intergenic
971786367 4:31108655-31108677 CAAAATGTTTAGAAGATGGCTGG + Intronic
973026945 4:45284483-45284505 GATTATATGTAGATGGTGGCAGG - Intergenic
973061741 4:45734902-45734924 TAAGATATTTAGCAGGTAGTAGG + Intergenic
974936879 4:68419312-68419334 TAATATTTTTAAAAGCAGGCTGG - Intergenic
975029538 4:69598271-69598293 TAATCTTTTTAGAAAGTTGCAGG - Intronic
975809707 4:78154484-78154506 TAATAGCTTTAAAAGGTGGGTGG - Intronic
975949103 4:79746589-79746611 TAATACAATTAGAAAGTGGCAGG - Intergenic
976276070 4:83279755-83279777 TACAATATTCAGAAGGTGCCAGG - Intronic
976290594 4:83413490-83413512 TAATATATTTTGCATGTGGGAGG + Intronic
977484925 4:97632937-97632959 AATTATATTTAGAAGGGGGATGG + Intronic
978906946 4:114016466-114016488 TAATTGATTTAGAAGATTGCTGG + Intergenic
978932969 4:114338845-114338867 TCATATTTTTAAAAGGTGGCTGG + Intergenic
981571262 4:146153108-146153130 TCATATAATTAGCAAGTGGCAGG + Intergenic
981735717 4:147948214-147948236 TATTATCTTTAAAAAGTGGCAGG - Intronic
985372961 4:189306759-189306781 TAATATTTTTAAAAGGAAGCAGG + Intergenic
986076665 5:4344886-4344908 ATATATATTTCAAAGGTGGCAGG - Intergenic
986867013 5:12001240-12001262 TGATATGTTTATAAGGTGCCAGG + Intergenic
987035974 5:14018524-14018546 TAATATTTGTATAAGGTGTCAGG + Intergenic
987390661 5:17372196-17372218 TAATATATTTAAAAAATGGATGG + Intergenic
988393951 5:30673010-30673032 TAATAAATATATAAGGTAGCTGG - Intergenic
988461174 5:31439187-31439209 TAATATTTTTAGATTGTGGTTGG - Intronic
988517806 5:31919815-31919837 TACTATATTTCCCAGGTGGCTGG - Intronic
989236586 5:39154886-39154908 TAATACAATTAAAAGGAGGCCGG - Intronic
989359571 5:40585332-40585354 TAATATATTTAGCACATGGGAGG + Intergenic
989458616 5:41670272-41670294 TGATTTATTCAGAAGGTGGCTGG + Intergenic
991502771 5:67293679-67293701 CAATATATTCAGACAGTGGCAGG + Intergenic
991516494 5:67441997-67442019 TAATAAATTTAGAAGGTGTAAGG + Intergenic
992847295 5:80763843-80763865 TAATTCATTTAAAAAGTGGCCGG + Intronic
993904659 5:93609722-93609744 TAATTTAATTGGGAGGTGGCTGG - Intergenic
997264742 5:132488835-132488857 TAACATACTTAGCAGGTGCCAGG + Intronic
997664049 5:135613849-135613871 TAATATATTTTGAAGTTAGGTGG + Intergenic
998448286 5:142215270-142215292 TAAAATATTTAGAAAGAGGCTGG - Intergenic
1000110885 5:158107211-158107233 TAAAGGATGTAGAAGGTGGCAGG - Intergenic
1000732336 5:164851645-164851667 TAATAAATTTAAAAGGAGTCCGG - Intergenic
1000758383 5:165189432-165189454 TTGTATATGTAGAACGTGGCTGG + Intergenic
1001861704 5:175061480-175061502 TAATCTATTGGGAAGGTGGGTGG - Intergenic
1003906186 6:10701782-10701804 TTATAAATTTAGGAGGTGGCTGG - Intronic
1004076043 6:12345003-12345025 TAATAAATTTAAAAAGTAGCTGG - Intergenic
1004538517 6:16526466-16526488 TAGAATATTCAGTAGGTGGCCGG + Intronic
1005133944 6:22545118-22545140 TAATAGATTTAAAAGGGAGCTGG + Intergenic
1005248502 6:23916403-23916425 TATTTAAATTAGAAGGTGGCAGG - Intergenic
1005460442 6:26064588-26064610 TAATATATTTAGTAAGTAGAGGG + Intergenic
1006270437 6:32961706-32961728 TAGTATATTTTGAAGTTGGGTGG - Intronic
1006481048 6:34294416-34294438 AAATTTTTTTAAAAGGTGGCTGG - Intronic
1008140870 6:47830649-47830671 TAATATATTTGCAATGTGTCTGG + Intronic
1008284466 6:49630581-49630603 TAATATATTTAGAGGGAGGAAGG - Intronic
1009762840 6:68030032-68030054 TAGTATAATTATAAGGTGGAAGG - Intergenic
1009987311 6:70796023-70796045 TAATATGTTGAGAAGGAGGCCGG - Intronic
1010528131 6:76928752-76928774 TAATATATTTATCAACTGGCCGG + Intergenic
1010762010 6:79734380-79734402 TTATATAGTTAGTATGTGGCTGG + Intergenic
1011898034 6:92256733-92256755 TAATATTTTTAGACCGTGGTCGG + Intergenic
1012005810 6:93711743-93711765 AAAAATATATAAAAGGTGGCCGG - Intergenic
1012554821 6:100498553-100498575 TAATTTTTTTAGAAGGTGTAAGG + Intergenic
1013154739 6:107482522-107482544 TAAGAAATTAAGAAGCTGGCAGG - Intergenic
1014051321 6:116958819-116958841 TAATATTTTTATATGGTGGAAGG - Intergenic
1015885734 6:137916140-137916162 TAAAATAAATAGAAGGAGGCAGG + Intergenic
1016196558 6:141350646-141350668 TAGCATATCTAGAAGGTGACAGG + Intergenic
1016310458 6:142727996-142728018 GAACATAGTGAGAAGGTGGCTGG + Intergenic
1016346107 6:143116212-143116234 TAAGATGTTTAGAATGTGGTGGG + Intronic
1016516380 6:144897085-144897107 GGATATAATGAGAAGGTGGCTGG - Intergenic
1016690152 6:146928668-146928690 TGATATAATTAGAAAGTGACAGG + Intergenic
1018327219 6:162684802-162684824 AAATATATTTAAAGGGAGGCTGG - Intronic
1020333191 7:7040941-7040963 CAATATAGGTTGAAGGTGGCAGG - Intergenic
1021186886 7:17575432-17575454 TAAAATATTTACAAGGTTGGGGG + Intergenic
1021519604 7:21526219-21526241 CCATATTCTTAGAAGGTGGCTGG + Intergenic
1021713118 7:23436050-23436072 TAAAAAATTTAGATGTTGGCCGG - Intronic
1028335765 7:89652741-89652763 TAAAATACTTAGAAGGTGTGAGG - Intergenic
1028643334 7:93068660-93068682 TAATATTTGTATAAGGTGGAAGG + Intergenic
1031076862 7:117221406-117221428 TGATATACTTAGAGGGTGCCAGG + Intronic
1032148290 7:129404015-129404037 TAAAATAGTGAGAAGGGGGCAGG + Intronic
1032208847 7:129893650-129893672 TAAAATATTTAGAAGCTAGAAGG + Intronic
1033030094 7:137818090-137818112 GAATATTTTGAGAAGATGGCAGG + Intronic
1033173583 7:139105262-139105284 TAACATAACTAGAAGCTGGCAGG - Intronic
1034072143 7:148196554-148196576 TAATACACTTAGAAAGTGCCGGG - Intronic
1034772683 7:153795119-153795141 TAATATTTATAGAATCTGGCCGG + Intergenic
1036018182 8:4809905-4809927 TAATATACTTGGTAAGTGGCCGG - Intronic
1038015741 8:23513084-23513106 TCTTACATTTAGAATGTGGCAGG + Intergenic
1038590516 8:28833026-28833048 TAACACATTTAGAAGGTGCCTGG + Intronic
1038969866 8:32620902-32620924 TAATATATTAAGTAGGTAGAAGG - Intronic
1039946917 8:42137810-42137832 TAACACATTTAGAATGGGGCTGG + Intergenic
1040642048 8:49346377-49346399 AAGTATTTTTAGCAGGTGGCTGG + Intergenic
1041336542 8:56791043-56791065 TAATAGATGTAGAAGGTGTTGGG + Intergenic
1041848614 8:62360473-62360495 TAACATGTTTAGAATGTGCCAGG + Intronic
1043028479 8:75102152-75102174 AATTATATTTAGAAGTTGGAAGG - Intergenic
1043547640 8:81333385-81333407 TAATATTTTTTGAGGGTGGAGGG + Intergenic
1045518916 8:102886275-102886297 AAATATATTGATAATGTGGCTGG + Intronic
1045593068 8:103620764-103620786 TAATTTATGTAGAAAGTGCCTGG + Intronic
1046709289 8:117491600-117491622 TAATTTATTTATAAGGTGTAAGG - Intergenic
1047001679 8:120579378-120579400 TAAAATATCTAGAATCTGGCAGG + Intronic
1047150469 8:122255828-122255850 TAAAATATTTGAAAGTTGGCTGG - Intergenic
1049653096 8:143784831-143784853 TACTATGTCTAGAAGGTGGAAGG + Intergenic
1050117118 9:2274681-2274703 TATTATATTTAAAAAGTGGGTGG + Intergenic
1050254290 9:3777994-3778016 TAATATAGCTAGAGAGTGGCAGG + Intergenic
1051004879 9:12331559-12331581 AATTGAATTTAGAAGGTGGCAGG + Intergenic
1051189909 9:14500391-14500413 TAAAACAATTAGAAGATGGCTGG + Intergenic
1051489011 9:17640036-17640058 TAATATATCTTGAATGTGGTGGG + Intronic
1051729200 9:20121859-20121881 TAATATAATTAAAAGGGGTCTGG - Intergenic
1053019028 9:34681911-34681933 TCACATAGTAAGAAGGTGGCTGG + Intergenic
1053235313 9:36448675-36448697 TAATATATTTAGAACTTATCTGG - Intronic
1054817265 9:69487092-69487114 TCATCTATTTGGAAGGAGGCAGG - Intronic
1055456273 9:76474916-76474938 TAATATATTTATCTGGAGGCTGG + Intronic
1055685614 9:78770809-78770831 TAATATGTTTAGAAAGGGGCTGG + Intergenic
1056719828 9:89062159-89062181 TAATATATACATAAGGTTGCAGG + Intronic
1056891459 9:90497638-90497660 CAATATGATTAGAAGCTGGCAGG - Intergenic
1058262833 9:102858004-102858026 TCAAATACTTAGAAGGTGTCAGG - Intergenic
1059537305 9:115093239-115093261 GAATATAATTAGAATGTGGTAGG - Intronic
1061716299 9:132520613-132520635 TTATTTATTTAGAAACTGGCTGG - Intronic
1061929027 9:133822772-133822794 GAATATTTTTAGATGGTGGGAGG - Intronic
1185554989 X:1014087-1014109 TCAGATATTTAGAAGGCGGCTGG - Intergenic
1187625764 X:21111691-21111713 TAATATACTTAGAAGCTTGGTGG + Intergenic
1187902951 X:24041526-24041548 TGGTATATTTAGAATGGGGCCGG + Intergenic
1187912289 X:24122105-24122127 TAATATATGTCTAAGGTGACAGG - Intergenic
1188229694 X:27646146-27646168 TAATATAGTTTGAAGTTGGGTGG - Intronic
1189279365 X:39810412-39810434 TAGTATATCTGGAAGGAGGCAGG + Intergenic
1190229141 X:48568297-48568319 TATGATATTTAAAAGGGGGCTGG + Intergenic
1192487889 X:71546332-71546354 TATTGTATTTAGAAGGTTTCAGG + Intronic
1192909935 X:75592600-75592622 TAATATTTCTAGAAGGATGCAGG + Intergenic
1193431989 X:81419055-81419077 TAATATTTCTAGAAGGTAGGAGG - Intergenic
1193662080 X:84269565-84269587 TAATATATGTTGAAGGTGGGAGG + Intergenic
1195624978 X:106998676-106998698 TAATTTAATTAGAAGGTGAAAGG - Intronic
1196329840 X:114458694-114458716 AAATATATTTAAAAGGGGCCGGG + Intergenic
1196331497 X:114475436-114475458 TAATATTTTTAAAAATTGGCTGG - Intergenic
1197286060 X:124596545-124596567 TAATTTAATTTGAAGGTGTCAGG + Intronic
1197951724 X:131904800-131904822 TAAAATATTTACCAGGTGACTGG - Intergenic
1198548612 X:137720315-137720337 TAATATTTGTTGAATGTGGCAGG + Intergenic
1199040788 X:143112517-143112539 TAATATTATTTAAAGGTGGCTGG + Intergenic
1199471858 X:148204458-148204480 TAATATTTTTAGACTGTGGTAGG - Intergenic
1200294488 X:154904618-154904640 TTATATTTTTGGAAGGTGGGAGG - Intronic