ID: 956431571

View in Genome Browser
Species Human (GRCh38)
Location 3:69191730-69191752
Sequence AATTTTGCACAGTTTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 238}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956431568_956431571 27 Left 956431568 3:69191680-69191702 CCAGTATAGTCAGCTGTTAGGCA 0: 1
1: 0
2: 0
3: 7
4: 73
Right 956431571 3:69191730-69191752 AATTTTGCACAGTTTGAGGATGG 0: 1
1: 0
2: 3
3: 16
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956431571 Original CRISPR AATTTTGCACAGTTTGAGGA TGG Intronic
902324136 1:15687549-15687571 AATTTTACAAGGTTTGAAGATGG + Intronic
908265050 1:62370046-62370068 AATTTTTTAGAGTTTGAGGCTGG - Intergenic
908888446 1:68816894-68816916 ACTTTTGCAAATATTGAGGAAGG + Intergenic
909122752 1:71625068-71625090 AATGTTGCACATTTTGATGTAGG + Intronic
910282307 1:85514717-85514739 AAGTTTGGACAGTTTGAATATGG - Intronic
910684186 1:89899506-89899528 ATTTTTGCAGAGCTTTAGGATGG + Intronic
911552423 1:99299656-99299678 CTTTTTGTAAAGTTTGAGGAGGG + Intronic
911637005 1:100247180-100247202 AATTTTGGACATTTTGCTGAAGG + Intronic
911844065 1:102726290-102726312 AACTTAACACAGTTTCAGGATGG + Intergenic
914207783 1:145549175-145549197 AAGTTTGGACAGTTTGAATATGG + Intergenic
914901672 1:151714505-151714527 AATTATGCTCAGTGTCAGGAGGG + Intronic
915282663 1:154833226-154833248 GATTTTGCCCAGTGTGGGGATGG - Intronic
915685542 1:157628909-157628931 TATTTTTCACAGTTGGAGGCTGG + Intergenic
918120112 1:181530896-181530918 AATTTTGCAGCTTTTGAAGAAGG + Intronic
918504692 1:185239482-185239504 AATTTTGCAAAGTTAGAAAAGGG + Intronic
922651994 1:227348549-227348571 TATTTTGCATAGGTTGAGCATGG - Intergenic
1064372451 10:14764500-14764522 AATTTTAGGCAGTTAGAGGAAGG - Intronic
1064920448 10:20511229-20511251 TATTTTGCAAAGGATGAGGAGGG + Intergenic
1065746648 10:28848432-28848454 AATTTTTCACAGTTTGAGGGAGG - Intronic
1066000476 10:31100228-31100250 AATTTTGCAGAAATTGAGGAGGG + Intergenic
1068744383 10:60513665-60513687 AATTTTTCACAGTATGTTGAGGG - Intronic
1070232108 10:74579453-74579475 GTTTTTGCATTGTTTGAGGAGGG - Intronic
1075219380 10:120571466-120571488 CATTTTACACACTGTGAGGAGGG - Intronic
1075219601 10:120573156-120573178 CATTTTACACACTGTGAGGAGGG + Intronic
1080684909 11:34507177-34507199 AATTCTTCACAGATTTAGGAAGG - Intronic
1080931175 11:36812916-36812938 AATTTTGCACAGACTGAGCTTGG - Intergenic
1081029252 11:38057237-38057259 ATTTTTGCATGGTATGAGGAAGG + Intergenic
1085658210 11:78336743-78336765 CATTTTTCACTGTTTGATGATGG - Intronic
1086614047 11:88793492-88793514 ATTTTTGCATATTCTGAGGAAGG + Intronic
1086886106 11:92207461-92207483 AATTTTGCTCAGTTTGAAGATGG + Intergenic
1087220617 11:95542803-95542825 AATCATGCTCAGTTTGAGTAGGG + Intergenic
1089141755 11:116290741-116290763 AACTTTGCAAAGTTTTAGGCAGG - Intergenic
1089422955 11:118345412-118345434 GATTTAGCACAGTTTCAGCAGGG + Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1093239658 12:16654466-16654488 ATTTTTGTACAGTGTAAGGAAGG + Intergenic
1093500038 12:19801424-19801446 AATTTTGTACATGTTGAGTATGG - Intergenic
1093848753 12:24009883-24009905 AATTTTGAAAAATTTAAGGAGGG + Intergenic
1099395993 12:82139704-82139726 TATTTTGCAAAGTTTGATAATGG - Intergenic
1099715978 12:86294591-86294613 AATTTTGTACAGTTGCAGAAAGG - Intronic
1101288717 12:103344112-103344134 GATTTTGCACAGCTGTAGGAGGG - Intronic
1101291845 12:103378206-103378228 AATTTTACAGAGTTTAGGGAAGG + Intronic
1106036177 13:26047410-26047432 AAGTTTGGACAGTTTGATTATGG - Intronic
1108808754 13:54193618-54193640 TATTTTACTAAGTTTGAGGAAGG - Intergenic
1109051300 13:57485186-57485208 AATTTGGCAAAATTTAAGGATGG + Intergenic
1109833275 13:67822801-67822823 TATTTTGCATAGTGTGAAGATGG + Intergenic
1110000867 13:70197867-70197889 AATTTGGAATATTTTGAGGAAGG + Intergenic
1110321863 13:74169669-74169691 TAATTTACACAGTATGAGGATGG - Intergenic
1110493118 13:76132947-76132969 AATTTAGCACAGTTGAAGAATGG - Intergenic
1110493683 13:76139585-76139607 AATAGTGAACAGTTTGGGGAAGG - Intergenic
1110695214 13:78479694-78479716 AATTTTGAAAAGTTGGATGAAGG - Intergenic
1111574641 13:90136180-90136202 AATTTTAAACAGTTTGGAGAGGG - Intergenic
1111818335 13:93183072-93183094 AATTATGCACACTGTGAGGAGGG - Intergenic
1112446730 13:99471280-99471302 AATCTTGCACAGTTAGAAGTGGG + Intergenic
1114005499 14:18308616-18308638 AATTTTGCCCATTTTGGTGAAGG - Intergenic
1118248852 14:64138717-64138739 AATCTTGAACCGTGTGAGGAAGG + Intronic
1118806662 14:69243549-69243571 AATTTTCAACAGTGTGGGGATGG - Exonic
1118870839 14:69740021-69740043 TATTTTGCCAAGGTTGAGGACGG + Intronic
1202891271 14_KI270722v1_random:160528-160550 TAATTTGCCTAGTTTGAGGATGG + Intergenic
1125339625 15:38661751-38661773 CATTTTCAATAGTTTGAGGATGG + Intergenic
1126420590 15:48468320-48468342 CATTTTGCAAACTTTGAGAATGG + Intronic
1129140081 15:73589905-73589927 AGTGTTCCAGAGTTTGAGGAAGG + Intronic
1130404275 15:83583952-83583974 GTTTTTGCATAGTTTGAGGATGG + Intronic
1132740947 16:1413079-1413101 AATTTTGCATAGTTTTTGTAGGG - Intronic
1146389017 17:32403862-32403884 TATCTTGTACAGTTTGAGTATGG + Intergenic
1147053919 17:37819294-37819316 AATTTTGCAGTATTTGAGGGTGG + Intergenic
1149148948 17:53535971-53535993 ATTTTTGGACATTTTGGGGAGGG - Intergenic
1149320578 17:55476932-55476954 AAATTTGCACATTTTCAGGGAGG + Intergenic
1149680183 17:58501042-58501064 AATTCTGCATAGTTTGGGGAAGG + Intronic
1150786969 17:68170808-68170830 ATTTTTGTAGAGGTTGAGGAGGG + Intergenic
1151219468 17:72601680-72601702 GATTCAGCACAGTTTGGGGAAGG - Intergenic
1154531933 18:15355268-15355290 AATTTTGCCCATTTTGGTGAAGG + Intergenic
1155302220 18:24440704-24440726 AATTTTCTCCAGTTTTAGGAAGG + Intronic
1156119741 18:33827848-33827870 AATTCTGCAGAGTTTAAGAAAGG - Intergenic
1157799819 18:50610124-50610146 ACTTTAGCAGAGTTTAAGGAGGG + Intronic
1158541904 18:58364913-58364935 AATGTTGAACAATTTGGGGATGG - Intronic
1158751434 18:60265819-60265841 AAATTTCCTCAGTTTGTGGAAGG + Intergenic
1158800117 18:60896399-60896421 AATTTTGCACAGTTGAGGGGAGG - Intergenic
1160257818 18:77262234-77262256 AGCTTTGCACTGGTTGAGGATGG + Intronic
1162678690 19:12321441-12321463 AATTCTGTACAGTTTGGGGGTGG + Intronic
1163225642 19:15959263-15959285 AATTTTGCTCGGTCTAAGGAAGG - Intergenic
1164331222 19:24259163-24259185 ACTTTTGCAGAGTTTGTGAAGGG - Intergenic
1164363398 19:27544634-27544656 ACTTTTGCAGAGTCTGAGAAGGG + Intergenic
1164838005 19:31370664-31370686 AATTTGGCAGAGGTTGAAGAGGG + Intergenic
1168676265 19:58279847-58279869 AAAGTTGCAGAGCTTGAGGAAGG - Exonic
1202666690 1_KI270708v1_random:127373-127395 TAATTTGCCTAGTTTGAGGATGG + Intergenic
925317807 2:2938894-2938916 AATTCTGCACAGTTAGATGAAGG - Intergenic
927932836 2:27056396-27056418 AATTTTGCATTGTTGGAGGGAGG + Intronic
928296762 2:30090466-30090488 CCTTTTGCACAGTGTCAGGAAGG + Intergenic
928517795 2:32060668-32060690 AATTTTAAAAATTTTGAGGAGGG + Intergenic
929050208 2:37829992-37830014 CAGTTTTCTCAGTTTGAGGAGGG - Intergenic
929684599 2:44022974-44022996 ATTTTTGGACAGGTTGGGGAGGG + Intergenic
929990033 2:46779243-46779265 AATTTTGCCCATTTTGAGATGGG + Intergenic
930893383 2:56417958-56417980 AATTTAGCCCAATTTGATGAGGG + Intergenic
932875799 2:75450060-75450082 AATTTTCCCCAATTTGGGGAAGG + Intergenic
933408129 2:81888885-81888907 AACTTTGCAGAGTTTGAATATGG - Intergenic
934935754 2:98464171-98464193 AATCTTGCACAGGCTGGGGAAGG + Intronic
936815183 2:116451830-116451852 AGTTTTGCATAGCTTGGGGATGG + Intergenic
937370456 2:121293921-121293943 AAACTTGCACAGCTGGAGGACGG + Intergenic
937403626 2:121607659-121607681 AATTTGGCACAGTATCAGGGAGG - Intronic
937568101 2:123321053-123321075 AATTTTGTACAGTCAGTGGAGGG + Intergenic
938249327 2:129801995-129802017 TATTTAGCAGAGTTTCAGGAAGG + Intergenic
939098027 2:137858211-137858233 AGTTTTGCAAAGTTTGAAAAGGG + Intergenic
940438359 2:153682486-153682508 AAGTGTGCACAGTTTGCAGAGGG - Intergenic
940589444 2:155702510-155702532 ATTTTTGCACATTTTTAGTATGG + Intergenic
941707008 2:168669566-168669588 TATTTTGCTCAGTATGAAGAGGG - Intronic
941886155 2:170529711-170529733 TATTTTGAAAAGTTTGAGAAAGG + Intronic
943745173 2:191454694-191454716 ATTTTTTCACAGTTGGAGGTGGG + Intergenic
944070670 2:195665025-195665047 AATTTAGCCCAGTGTGAGGTCGG + Intronic
945047243 2:205792708-205792730 AATCTTGAATAGTGTGAGGAAGG - Intronic
945285759 2:208079539-208079561 TATTTTGCCAAGGTTGAGGACGG - Intergenic
945524834 2:210875137-210875159 AATATTGCCAAGTCTGAGGAAGG - Intergenic
945570177 2:211457610-211457632 AATTTTGCACAGGGAGATGAGGG + Intronic
946079531 2:217105769-217105791 TATTCTACAGAGTTTGAGGATGG + Intergenic
946524098 2:220498949-220498971 AGTTTTGTACAGTTTGGAGAGGG + Intergenic
947102031 2:226631077-226631099 GATTTGGCTCAGTTTGGGGAAGG - Intergenic
1169778467 20:9282677-9282699 AATTCTGCAAAATTTGAGGGTGG - Intronic
1169819573 20:9694537-9694559 ACTTGGGCACAGCTTGAGGAAGG - Intronic
1170203419 20:13769487-13769509 AATTTTGAATACTTTGAGGCTGG + Intronic
1174825268 20:53762828-53762850 ATTTTTGAAGAGTTTGAGGCAGG - Intergenic
1174962685 20:55176068-55176090 AATTTTGAACACTTCTAGGAAGG - Intergenic
1175015922 20:55790523-55790545 AGTATTGCACGGTTTGGGGAGGG - Intergenic
1175509784 20:59516129-59516151 AATTTTGTGAGGTTTGAGGATGG - Intergenic
1176765431 21:13012921-13012943 AATTTTGCCCATTTTGGTGAAGG - Intergenic
1177399597 21:20585605-20585627 AAATTTCCTCAGTTTGAGAAAGG + Intergenic
1177510904 21:22086679-22086701 AATTGTGCACACTCTGAGGCTGG - Intergenic
1177679186 21:24341810-24341832 AATTTTTCACAGATGGGGGAAGG + Intergenic
1178400610 21:32281829-32281851 AATTTTGCCCAATCTGAGTAAGG + Intergenic
1178455389 21:32745294-32745316 AATTATACAGAGTTTGAGGGAGG - Intronic
1178842847 21:36151747-36151769 TATTTTGCCAAGGTTGAGGATGG - Intergenic
1180430008 22:15239402-15239424 AATTTTGCCCATTTTGGTGAAGG - Intergenic
1182670191 22:31989298-31989320 GATTTTGCACAGCAGGAGGAGGG + Intergenic
1184594375 22:45504906-45504928 AATTTGGTACAGTTTGGGAAGGG + Intronic
949162600 3:898598-898620 AATGTTCCAGAGTTTGATGATGG + Intergenic
949775576 3:7629000-7629022 ATTATTGCAAAGTTTGAGGATGG - Intronic
950617613 3:14174321-14174343 AAGATTTGACAGTTTGAGGAGGG + Intronic
951128135 3:19008240-19008262 AGTCTGGCACATTTTGAGGATGG - Intergenic
951250151 3:20384907-20384929 AAGTTTGAACAGTTTGTAGAAGG + Intergenic
952742846 3:36750966-36750988 AATTTTGCCCAGTTGGATGTTGG - Intergenic
956431571 3:69191730-69191752 AATTTTGCACAGTTTGAGGATGG + Intronic
956447696 3:69341870-69341892 TATTTTTCACAGTGTGAGGCTGG - Intronic
957022718 3:75142456-75142478 AATTGTCCTCAGTCTGAGGAAGG - Intergenic
957089195 3:75712197-75712219 TAATTTGCCTAGTTTGAGGATGG - Intronic
957546378 3:81643594-81643616 AATTTTACACAGGTTAAGAAAGG - Intronic
957901462 3:86499413-86499435 ATTTTTACACAGTGTGAGAATGG - Intergenic
958135926 3:89490797-89490819 AAAATTTCACAGTTTGGGGATGG - Intergenic
959053538 3:101547284-101547306 AATTTTGCAAAGGTTGTTGAAGG - Intergenic
960328124 3:116321785-116321807 AATTTAGTACAGTCTGAGGCTGG + Intronic
960515977 3:118603243-118603265 AAGTTTCCACAGACTGAGGAAGG - Intergenic
960536346 3:118818699-118818721 GATTTTGGACAGTTTGGGGATGG - Intergenic
961933620 3:130560086-130560108 AATTTTGGACAGTTGGTAGAAGG - Intergenic
962541096 3:136383080-136383102 GATTTTGCTCAAGTTGAGGAAGG + Intronic
962630254 3:137268743-137268765 TATTTTTTAAAGTTTGAGGAGGG - Intergenic
963217195 3:142761622-142761644 ATTTTTGAAGAGTTTGAGTAAGG + Intronic
965385179 3:168037002-168037024 TAAATTGCACAATTTGAGGAGGG + Intronic
966434223 3:179865225-179865247 TATTTTCCACATTTTTAGGAAGG + Intronic
966674000 3:182565135-182565157 AATTTTACAAAGTTTGTGAAGGG - Intergenic
967623024 3:191657531-191657553 AATTTTGGTCAGTGTGTGGATGG + Intergenic
969994344 4:11296103-11296125 AATTTTGCACTGACTGAAGATGG + Intergenic
970139353 4:12964476-12964498 AATTCTCCACACTTTGAGGGAGG - Intergenic
972255137 4:37346182-37346204 AATTTTACACGGTGTGAGGTAGG + Intronic
974436864 4:61867789-61867811 AAATATGCACAGTTTGAGGATGG - Intronic
975569648 4:75801711-75801733 AATTGTGCACAGTTTATGGCAGG + Intronic
975852144 4:78583418-78583440 TATGTTGCTCAGTTTGAGGCTGG - Intronic
976199650 4:82565476-82565498 AATTTTACAAAGTTTGTGGCTGG - Intergenic
976867071 4:89741868-89741890 ACCTGTGCACAGTTTGAGAAAGG - Intronic
977091362 4:92680574-92680596 AATCTTGAACAGTTTGATAAAGG + Intronic
978647363 4:110952319-110952341 AATTTTGCACAATTTAATGAAGG + Intergenic
979825919 4:125231913-125231935 GATCTTGCCCAGTTTGAAGATGG + Intergenic
979947525 4:126851911-126851933 ATATTTGCGCAGTTTGAGTAAGG - Intergenic
982966126 4:161910595-161910617 AATTTGCCACAGATTGAGTATGG - Intronic
983100706 4:163622537-163622559 AATTTTGCACAATATAAGGAAGG - Intronic
983923943 4:173376018-173376040 ATTTTTGCACAGATTGAGGGTGG - Intronic
984609289 4:181819594-181819616 AATTTTCCACAGATGGAGGGTGG + Intergenic
984836961 4:184031405-184031427 AATAATACACTGTTTGAGGAAGG + Intergenic
985869644 5:2544160-2544182 AAGTTTGCACACTTTGAGAACGG + Intergenic
988571623 5:32373077-32373099 TATTCTGCACAGTTGAAGGAGGG - Intronic
989805128 5:45594437-45594459 CATTTTGAACATTTTGAGCAAGG - Intronic
990196265 5:53319959-53319981 AATTTTGCAAAGTTTAGGGGTGG - Intergenic
990546018 5:56822442-56822464 AATATTTGACAGTTTGAGCATGG - Intronic
992033528 5:72748373-72748395 AATTTTGCAGAATTTTAGGTTGG - Intergenic
992711274 5:79459826-79459848 ACTGTTGCACAGTGGGAGGAGGG + Intronic
993792835 5:92228464-92228486 AGTTTTGGAGAGTTTGAGGCTGG - Intergenic
994577613 5:101599520-101599542 AGTTTTGTACATTTTGAGAATGG - Intergenic
996116634 5:119627464-119627486 AATTTTCCACAGTTTGGAAATGG - Intronic
996589102 5:125126074-125126096 AATTTTGGACATTTTGTTGAAGG - Intergenic
996672453 5:126134559-126134581 AGATTTGAAGAGTTTGAGGAAGG - Intergenic
997860513 5:137411285-137411307 AATTATCCACAGAATGAGGACGG + Intronic
998685959 5:144525449-144525471 AATTTTGCATAGTTTTTTGAAGG - Intergenic
1000908039 5:166987282-166987304 AATCGTACACAGTTTGGGGAGGG + Intergenic
1003395970 6:5752185-5752207 AATTTTGCACAGATTTCTGATGG - Intronic
1004023361 6:11795108-11795130 ATTTTCACACAGTTTGAGGATGG - Intronic
1004516043 6:16323166-16323188 AATTTTGCAAAGTTTGGAGTAGG + Intronic
1005527498 6:26665321-26665343 AATTTTCCACAGATGGTGGAGGG - Intergenic
1008650486 6:53556199-53556221 TATTTTGCCAAGGTTGAGGATGG - Intronic
1008660396 6:53661931-53661953 AACTTTGCAAAGTTGGATGAGGG + Intronic
1008768958 6:54955288-54955310 AACTTTGCACAAGTTGAAGAGGG - Intergenic
1008863901 6:56186757-56186779 AATTTTGCAATGTTTCAGTACGG - Intronic
1009452733 6:63820162-63820184 AATTTTTGACAGTCTGATGAGGG + Intronic
1011370249 6:86629484-86629506 AATTTGGCTCACTGTGAGGAGGG - Intergenic
1012459382 6:99443806-99443828 ATTTTAGCAGAGTTTTAGGAAGG - Intronic
1013437819 6:110130182-110130204 CATGTTGCACAGTTTTAGAATGG - Intronic
1014204262 6:118639673-118639695 CATTTTTCACAGTTTGGTGAGGG - Intronic
1014503122 6:122218356-122218378 AATTTTACAAAGTGTGAGTAGGG + Intergenic
1014836883 6:126169759-126169781 AGATTTGCACAGTTCTAGGAAGG - Intergenic
1015331674 6:131987132-131987154 AATTTTGCAAAATTTAAGGCAGG - Intergenic
1016878911 6:148890661-148890683 AATATTGGACAGAATGAGGACGG - Intronic
1019099981 6:169622324-169622346 TATTTTGCCCAGGTTGGGGATGG - Intronic
1020780264 7:12509057-12509079 ACTTTTCCACAGACTGAGGAAGG - Intergenic
1021505919 7:21384970-21384992 AACTTTGCAGAGTTGGGGGAGGG + Intergenic
1021607816 7:22426902-22426924 AATTTTACACGGTTTGGTGAAGG + Intronic
1023636608 7:42217680-42217702 AAGTTTGCACATCTTAAGGAGGG - Intronic
1023709224 7:42974248-42974270 CAGTTTGCACTGTGTGAGGATGG + Intergenic
1024795469 7:53014480-53014502 AATTTTCCACAGTTTGCACATGG - Intergenic
1026072425 7:67133941-67133963 TATTTTCCACAGGATGAGGAGGG - Intronic
1026430411 7:70341392-70341414 GATTTTTCACAGTTTCAGAAGGG - Intronic
1026469588 7:70683798-70683820 AAATTAGCACAGTTTGTAGATGG - Intronic
1026704474 7:72678297-72678319 TATTTTCCACAGGATGAGGAGGG + Intronic
1029316147 7:99716412-99716434 AATTTTCCAAAGCTTGAGCAGGG - Intronic
1029321810 7:99769002-99769024 AATTTTCCAAAGCTTGAGCAGGG - Intronic
1030026949 7:105333651-105333673 CATTTTGTACAGTTTTATGAGGG + Intronic
1030515839 7:110536748-110536770 TATAGTGGACAGTTTGAGGAGGG - Intergenic
1030618640 7:111765713-111765735 AATCTTGCACAGGTTGGGCAAGG + Intronic
1032889357 7:136177967-136177989 AGTTTTACAATGTTTGAGGATGG + Intergenic
1033561308 7:142535052-142535074 AATTTTGCACAGGTTGGTGAGGG - Intergenic
1034244388 7:149633638-149633660 AATATTGCATAGTTTCCGGAAGG + Intergenic
1037076230 8:14722652-14722674 AATTTTACACAGGTTGACTAGGG + Intronic
1037093181 8:14947991-14948013 ATTTTTGCATTGTTTGAAGAAGG + Intronic
1037791921 8:21951989-21952011 ATTTTTGCACAATGTGGGGATGG - Intronic
1040968095 8:53104391-53104413 ACTATTTCACAGTTTAAGGAGGG + Intergenic
1041938763 8:63363794-63363816 AATTTTGCTCAGTTTGCAGTGGG - Intergenic
1041980378 8:63851353-63851375 AATATCGCACAGATGGAGGATGG - Intergenic
1044382583 8:91551787-91551809 AGTGGTCCACAGTTTGAGGAAGG - Intergenic
1044937550 8:97307802-97307824 AATTTTAGACAGATTGAAGAGGG + Intergenic
1045962162 8:107980828-107980850 TATTTTGCACAGTTATAGAAGGG - Intronic
1049663307 8:143830166-143830188 AATTTTGGAAGGTTTCAGGAGGG - Intergenic
1050126230 9:2359032-2359054 AATTATGGACAGTTTGGGTAAGG - Intergenic
1051759146 9:20441480-20441502 AATTTTCCAGAGTTTGTGGGGGG + Intronic
1052661172 9:31434124-31434146 TATTTTAAACAGTTTAAGGAAGG - Intergenic
1053594227 9:39543754-39543776 AAGTTTGCACTGTTTGCAGAGGG + Intergenic
1053852007 9:42298800-42298822 AAGTTTGCACTGTTTGCAGAGGG + Intergenic
1054572026 9:66821203-66821225 AAGTTTGCACTGTTTGCAGAGGG - Intergenic
1054996219 9:71393470-71393492 AATTTGGTAGAGCTTGAGGATGG + Intronic
1055182395 9:73403203-73403225 AATTTTCCAGAGTGTGAGGTGGG - Intergenic
1055715832 9:79117048-79117070 GATAGTGCACATTTTGAGGATGG - Intergenic
1058108250 9:101000836-101000858 AATTTTGCTTAGTTGGAAGATGG + Intergenic
1059300476 9:113308546-113308568 AATTTTTCATAATTTTAGGAAGG + Intergenic
1060310905 9:122460963-122460985 AATTTAGCAAAGTTTCAGGATGG - Intergenic
1187114551 X:16335902-16335924 AATTTTGCTCATTTTTAGGAGGG + Intergenic
1192972694 X:76250747-76250769 CATCTTGCCCAGGTTGAGGAGGG - Intergenic
1194479682 X:94405334-94405356 AATTTTACTCAGTTGGATGATGG + Intergenic
1195142812 X:101980175-101980197 AATTTTGTACCCTTTGATGAAGG - Intergenic
1195243539 X:102976720-102976742 GAGTTTACACAGCTTGAGGATGG - Intergenic
1195588673 X:106598599-106598621 GATTTTCCACAAATTGAGGAAGG - Intergenic
1196293924 X:113977736-113977758 TATTTTGCCAAGGTTGAGGATGG - Intergenic
1197046984 X:122009464-122009486 AATTTTACACAGTTTGTAAATGG + Intergenic
1197932385 X:131709376-131709398 AATTTTGCACAGTCCAAGGTTGG + Intergenic
1199323198 X:146465490-146465512 AGTTTTGAACAGTTTGAGTAGGG - Intergenic
1201170251 Y:11253494-11253516 AATTTTGCACAGACTGGGAAGGG + Intergenic