ID: 956432707

View in Genome Browser
Species Human (GRCh38)
Location 3:69203750-69203772
Sequence CTGAATTTTGATACTGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956432707 Original CRISPR CTGAATTTTGATACTGAGCC AGG (reversed) Intronic
902170764 1:14609016-14609038 TAGAAATTTGATACTGGGCCTGG + Intronic
907725448 1:57016113-57016135 CTGAATGTTGATCCTGTGTCAGG - Intronic
908572931 1:65427905-65427927 CTGTATCTTGATAGTGAACCAGG + Intronic
909240608 1:73207828-73207850 CTTAATTTTGATATTTGGCCAGG - Intergenic
910750942 1:90629595-90629617 TAGAATTTTGAGACTGAGCATGG + Intergenic
910782274 1:90952081-90952103 CTGAATTTTAATTCTAAGACTGG - Intronic
911745027 1:101432284-101432306 CTGAATATTAATAATGAGCCTGG + Intergenic
913672105 1:121106622-121106644 TTGAATTTTGATCCTTAGCCTGG - Intergenic
914023870 1:143893980-143894002 TTGAATTTTGATCCTTAGCCTGG - Intergenic
914264157 1:146023341-146023363 TTCAATTTTGAGACTGAGACTGG - Intergenic
914662359 1:149802018-149802040 TTGAATTTTGATCCTTAGCCTGG - Intronic
916192101 1:162189844-162189866 CTGAATATTGCCAATGAGCCAGG + Intronic
918334591 1:183496003-183496025 CAGAATTCTGATACTGTGCCTGG + Intronic
918466133 1:184823287-184823309 CTGAAACTTGATGCTGAACCAGG + Exonic
920295542 1:204954086-204954108 GGGAATTTTGGTACTGAGCCAGG + Intronic
921413248 1:214859303-214859325 TTGACTTCTCATACTGAGCCAGG - Intergenic
921772366 1:219056379-219056401 CTTAATCTTGATATTGAGCTGGG + Intergenic
922643501 1:227260929-227260951 CAGAATTTAGACACAGAGCCTGG - Intronic
1065446996 10:25813146-25813168 CAGAATGTTGATATTGGGCCGGG - Intergenic
1066349286 10:34622310-34622332 CTGAATTTTCAGACTGAAGCTGG + Intronic
1070544375 10:77441116-77441138 TTGAATTTTGATTCTTGGCCGGG - Intronic
1070783077 10:79148624-79148646 CTGAATGTGGATTCTGGGCCGGG + Intronic
1071004022 10:80861528-80861550 CTGCATTTTTCTTCTGAGCCTGG - Intergenic
1072473247 10:95733834-95733856 CATAATTTTGACAATGAGCCAGG - Intronic
1072933086 10:99684873-99684895 CTGGATTTTGATCCTGATCTAGG + Intronic
1074907117 10:117874559-117874581 CAGACTTTTCCTACTGAGCCGGG - Intergenic
1078222733 11:9364865-9364887 CTGCATTTTGGAACTGAGTCAGG - Intergenic
1079652108 11:22942597-22942619 CAGAATTTTGATGCAGAGGCAGG - Intergenic
1079816885 11:25072358-25072380 CTGAATTTCTATTATGAGCCAGG - Intronic
1083797912 11:65028650-65028672 CTGTATTTTAATATTGATCCGGG - Intronic
1089022762 11:115234133-115234155 CTGAGTTTTCAGGCTGAGCCTGG + Intronic
1090502322 11:127273435-127273457 ATGAATGTTGATTCTGAGTCAGG - Intergenic
1092648121 12:10601944-10601966 CTGACATGTTATACTGAGCCAGG + Intergenic
1094610221 12:31988601-31988623 CTGTATTTTAATAATGAGACCGG + Intronic
1096791641 12:54048576-54048598 ATGAATTCTGATGCTGACCCTGG + Intronic
1096980380 12:55725233-55725255 ATGAATGTTCATAGTGAGCCTGG + Intergenic
1098105144 12:67061902-67061924 CAGTATCTTGATACAGAGCCTGG - Intergenic
1099026996 12:77477326-77477348 ATGAATCTTGCTACTGATCCTGG - Intergenic
1103480670 12:121248082-121248104 TTGAATTTGGATCCTGACCCAGG - Intronic
1107811961 13:44209060-44209082 CTGCATTTAGATCCTTAGCCAGG + Intergenic
1107815077 13:44237474-44237496 GTGACTCTTGATTCTGAGCCTGG - Intergenic
1110516369 13:76417532-76417554 GTGATTTTTGACACTGATCCAGG - Intergenic
1115052046 14:29074442-29074464 CTGAATTTTGATGAGGAGACAGG - Intergenic
1122360213 14:101155028-101155050 CAGAATTTTGATAATGGGCAGGG - Intergenic
1124617414 15:31251653-31251675 CAAAAGTTTGATTCTGAGCCTGG + Intergenic
1126075108 15:44901486-44901508 ATAGATCTTGATACTGAGCCGGG - Intergenic
1126083255 15:44986322-44986344 ATAGATCTTGATACTGAGCCGGG + Intergenic
1128583213 15:68823613-68823635 CTGAATTTTGAAACGGAGTTGGG + Intronic
1130320315 15:82835837-82835859 AGGAAGTTTGATGCTGAGCCTGG - Exonic
1131967609 15:97860661-97860683 CTGAATTTTGATAGTAACCTTGG + Intergenic
1133015990 16:2940643-2940665 CAGAAGTTTGAGACTCAGCCTGG - Intronic
1135777316 16:25268036-25268058 TTGAATTTTTATTATGAGCCAGG + Intergenic
1141227921 16:82136807-82136829 CTGAGTCTTGACACTGGGCCAGG - Intergenic
1141921551 16:87139005-87139027 CTGAATTTTGAGACCGGGCGTGG - Intronic
1150586485 17:66522955-66522977 ATGAATTCTGTTACTGATCCCGG + Intronic
1152037257 17:77881062-77881084 CTGAATAATGATGCTGAGCTCGG - Intergenic
1154395807 18:13987534-13987556 CTGATTTGTGATGCTGGGCCTGG + Intergenic
1155505790 18:26531538-26531560 TTGAATTTTGATACTGGGTCAGG - Intronic
1155708539 18:28847141-28847163 CTGATCTGTGATCCTGAGCCGGG - Intergenic
1155904782 18:31436928-31436950 CTGAATTGTGATCCTTAGCTGGG - Intergenic
1155931477 18:31713379-31713401 CTAAATTTTATTACTGAGCACGG + Intergenic
1156586105 18:38432994-38433016 CTGAATATTTATAATGAGCCAGG + Intergenic
1157190996 18:45581359-45581381 CTTAGCTTGGATACTGAGCCTGG - Intronic
1158679623 18:59555440-59555462 CTGAATTATGACACTGGACCTGG - Intronic
1159587619 18:70296247-70296269 CTGAAATTTTATACACAGCCAGG - Intronic
1160689199 19:453273-453295 CTGAGTTTTGTTTCTGAGGCAGG + Intronic
1164588153 19:29490518-29490540 CTGAGTTTTTAAACTCAGCCTGG + Intergenic
1167222608 19:48212038-48212060 CTGAATTTTGACTCTAAGCTTGG - Intronic
1167575035 19:50313957-50313979 CAGAATTCTGAGACTGACCCTGG - Intronic
1168236984 19:55069631-55069653 CTCAATTTCGAGAATGAGCCAGG - Intronic
1168422082 19:56210925-56210947 TTTAATTTTGAGACTGAGTCTGG - Intergenic
933929826 2:87138212-87138234 CTTAATTTTGATAGTCATCCTGG - Intergenic
934001158 2:87714004-87714026 CTTAATTTTGATAGTCATCCTGG - Intergenic
935629857 2:105204443-105204465 CTGAAATATGATACTGGGCTTGG + Intergenic
936363112 2:111825189-111825211 CTTAATTTTGATAGTCATCCTGG + Intronic
939094300 2:137816382-137816404 CTGCCTGTTGATCCTGAGCCTGG + Intergenic
942326011 2:174777782-174777804 CTGAATCTTTACACTGGGCCTGG + Intergenic
942607830 2:177710585-177710607 CTGAATTGTTAGACTGAACCAGG + Intronic
944396657 2:199275396-199275418 CTGAATGTTTATTCTGTGCCAGG + Intronic
944705237 2:202282142-202282164 CTCATTTTTGCTACAGAGCCAGG - Intronic
944863194 2:203834961-203834983 ATGATTTGTGATGCTGAGCCTGG - Intergenic
946320703 2:218952704-218952726 CTGAATATTAATTCTGGGCCAGG - Intergenic
1170864661 20:20142667-20142689 CCGAATTTTGACACTGAGGAGGG - Intronic
1172031846 20:31987893-31987915 CAGGATTTTGGAACTGAGCCAGG + Intronic
1172482928 20:35281807-35281829 CTGAACTCTCATACTGAGACAGG + Intronic
1174373001 20:50106224-50106246 CTGACTTTTGATACTGACACAGG - Intronic
1174769026 20:53281017-53281039 CTGTATTTAGATACTATGCCAGG + Intronic
1174808993 20:53629899-53629921 CTGAGATTTGATAGTGAGGCAGG + Intergenic
1176289892 21:5038174-5038196 CTGAATTTCCATGATGAGCCGGG + Intronic
1177520797 21:22221492-22221514 CTCACTTTTGTTACTGTGCCAGG + Intergenic
1178436582 21:32564911-32564933 CTCAATTTTGATGTTGACCCAGG + Intergenic
1179867359 21:44225465-44225487 CTGAATTTCCATGATGAGCCGGG - Intronic
1182106910 22:27696111-27696133 CTAGTTTTTGAGACTGAGCCAGG - Intergenic
1184336154 22:43854467-43854489 CTGAATTTTGATTTTGGGCAAGG - Intronic
952009854 3:28888082-28888104 TTGATATTTGAGACTGAGCCTGG + Intergenic
952254302 3:31682260-31682282 CTGAACTATGAGATTGAGCCTGG + Intronic
955698549 3:61660466-61660488 CAGAGTTTGGATACTGAGGCTGG + Intronic
955842453 3:63126704-63126726 CTGATGTGTGATTCTGAGCCAGG - Intergenic
956432707 3:69203750-69203772 CTGAATTTTGATACTGAGCCAGG - Intronic
960067183 3:113386724-113386746 CTGATTTTTGATTCTTAGCAAGG - Intronic
961736932 3:129008124-129008146 TTTAATTTTGATACTTAGCGTGG + Intronic
962098949 3:132321518-132321540 CTGAGAGTTGGTACTGAGCCAGG + Intronic
965295671 3:166942872-166942894 CTGCTTTGTGATCCTGAGCCAGG - Intergenic
970287589 4:14535428-14535450 CTGAACTTTGATATGGAGGCAGG + Intergenic
972491235 4:39589380-39589402 CTGAAATTTGTTTCTGGGCCAGG - Intronic
973848828 4:54940784-54940806 CTGAATTTGAATTCTGACCCTGG + Intergenic
974266226 4:59589504-59589526 CTGACTTTTAATAATGAGGCTGG - Intergenic
974574131 4:63695167-63695189 CTCAATTCTGATATTGATCCTGG + Intergenic
975249284 4:72159444-72159466 ATGAGTTTTTATAATGAGCCAGG + Intergenic
975715157 4:77198430-77198452 CTTATTCTTGGTACTGAGCCTGG + Intronic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
978723579 4:111944097-111944119 CTAAATTTTGAACCTCAGCCAGG + Intergenic
987511667 5:18847649-18847671 CTGAATTTTGCTGCAGAGGCAGG - Intergenic
988000798 5:25345474-25345496 CTGAATTGTGATAATCACCCAGG + Intergenic
988197610 5:28025359-28025381 CTGAATTTATATACTGATTCTGG - Intergenic
988269938 5:29001126-29001148 CTGATTTTTGATAAGGGGCCTGG + Intergenic
990995758 5:61730733-61730755 CTGCATTTGGATACTGAACTGGG + Intronic
991459568 5:66843796-66843818 GGGAATTTTGATACACAGCCAGG + Intronic
993675096 5:90807354-90807376 CTGGATTTTGTCATTGAGCCAGG + Intronic
993919462 5:93782455-93782477 CTAAATTTTGATAATGACTCTGG - Intronic
997753214 5:136369984-136370006 CTGTATTTTGTGACTGAGCAAGG + Intronic
999426744 5:151494152-151494174 CTGAATTTGGACCCTAAGCCTGG + Intergenic
999943755 5:156573232-156573254 TTGGATTTGGATAATGAGCCTGG + Intronic
1000782265 5:165497081-165497103 GTGAATTTTGAAAATGAGACTGG + Intergenic
1000828038 5:166070460-166070482 CAGAGTTGTGATACAGAGCCTGG - Intergenic
1001341850 5:170854438-170854460 CAGAATTTTGAAAATGGGCCAGG - Intergenic
1003732390 6:8839788-8839810 CTGAATGTTGATATTGACCATGG - Intergenic
1005672427 6:28120555-28120577 CTGAAGTTGGATGATGAGCCAGG + Intergenic
1009808891 6:68635863-68635885 CTGATTTTGGAAGCTGAGCCGGG + Exonic
1016604015 6:145898500-145898522 CTGAAATTTGATACCCAGCGTGG + Intronic
1018618975 6:165712528-165712550 CTGAATTTGCAAACTGATCCAGG - Intronic
1024510761 7:50203044-50203066 CTAAATTTTGAATCTGACCCTGG + Intergenic
1026505344 7:70977854-70977876 CTGTATTTTTAGACAGAGCCTGG - Intergenic
1027054266 7:75039251-75039273 CTGAGTTTTGATTCTGGCCCAGG + Intronic
1028601664 7:92607318-92607340 CTTAATTTAGAAACTGTGCCAGG - Exonic
1029930642 7:104366873-104366895 CTGAATTTTGAAAGATAGCCAGG + Intronic
1033500504 7:141944388-141944410 ATGAATTTTCATACTGAATCTGG - Intronic
1033513063 7:142079698-142079720 CTGAAGTCTAATACAGAGCCTGG + Intronic
1033574831 7:142670890-142670912 ATGGACTTTGATGCTGAGCCAGG - Intergenic
1037127098 8:15364958-15364980 CTGAAATTAGATACTGATCATGG + Intergenic
1037475878 8:19257259-19257281 CTGGATTTTGATAGTCAGGCAGG + Intergenic
1042040388 8:64582435-64582457 ATAAATTTTGATTCTGAGCCAGG + Exonic
1043301306 8:78736963-78736985 CTGAATTTTCTTCATGAGCCAGG - Intronic
1046314844 8:112486146-112486168 CTTAATTCTCATACTTAGCCTGG + Intronic
1050209111 9:3233428-3233450 CTGACTTTTCATAGTGAGGCAGG + Intronic
1050950284 9:11582450-11582472 CTTCATTTTAATACTCAGCCAGG - Intergenic
1051107812 9:13600515-13600537 CTGTATCTTGATAATGAGGCTGG - Intergenic
1051221485 9:14852766-14852788 GTGAATTTGGTAACTGAGCCTGG - Intronic
1051259999 9:15253971-15253993 CTCAATGTTGACACTGAGCCAGG - Intronic
1052034622 9:23666327-23666349 GTGCTTTGTGATACTGAGCCAGG + Intergenic
1052799816 9:32956701-32956723 CTGAAACTGGTTACTGAGCCTGG - Intergenic
1056594663 9:87997155-87997177 CTGATTTTTAATACTGTACCTGG - Intergenic
1059128351 9:111716844-111716866 TTGAATGTTGATACTGGACCAGG + Intronic
1060149432 9:121278823-121278845 CTGAGTTTTCAAACTCAGCCAGG - Intronic
1061923255 9:133793691-133793713 CTGTACTTTGATACAGAGGCAGG + Intronic
1186700774 X:12087451-12087473 CTGAATCTTGATGCTGACCCTGG - Intergenic
1187231657 X:17429398-17429420 CTGGATTTTGATACCCAGCAAGG - Intronic
1187306282 X:18098324-18098346 CTGGAGTTTGAGACTTAGCCTGG + Intergenic
1187341854 X:18427770-18427792 ATAAATTTTAAGACTGAGCCAGG - Intronic
1189229370 X:39440277-39440299 CTGAATTCTGATGCTAGGCCAGG - Intergenic
1189393237 X:40595880-40595902 CTTAATATTGATGCTGGGCCTGG + Intronic
1191627649 X:63285815-63285837 CTTAATTTTGATATTTACCCAGG - Intergenic
1192468293 X:71373979-71374001 TAGAATTTTCATACTGGGCCAGG - Intronic
1196970475 X:121102535-121102557 CTTAATATTGATACTTAGGCTGG - Intergenic