ID: 956432788

View in Genome Browser
Species Human (GRCh38)
Location 3:69204340-69204362
Sequence TCCTGATGTCTTTCCTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 263}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956432788_956432792 17 Left 956432788 3:69204340-69204362 CCAGGACAGGAAAGACATCAGGA 0: 1
1: 0
2: 2
3: 15
4: 263
Right 956432792 3:69204380-69204402 TGGCAACTCATAGTACCTATAGG 0: 1
1: 0
2: 0
3: 4
4: 66
956432788_956432791 -3 Left 956432788 3:69204340-69204362 CCAGGACAGGAAAGACATCAGGA 0: 1
1: 0
2: 2
3: 15
4: 263
Right 956432791 3:69204360-69204382 GGAGAGGCTTGGCTTTTTAATGG 0: 1
1: 1
2: 1
3: 15
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956432788 Original CRISPR TCCTGATGTCTTTCCTGTCC TGG (reversed) Intronic