ID: 956432788 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:69204340-69204362 |
Sequence | TCCTGATGTCTTTCCTGTCC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 281 | |||
Summary | {0: 1, 1: 0, 2: 2, 3: 15, 4: 263} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
956432788_956432792 | 17 | Left | 956432788 | 3:69204340-69204362 | CCAGGACAGGAAAGACATCAGGA | 0: 1 1: 0 2: 2 3: 15 4: 263 |
||
Right | 956432792 | 3:69204380-69204402 | TGGCAACTCATAGTACCTATAGG | 0: 1 1: 0 2: 0 3: 4 4: 66 |
||||
956432788_956432791 | -3 | Left | 956432788 | 3:69204340-69204362 | CCAGGACAGGAAAGACATCAGGA | 0: 1 1: 0 2: 2 3: 15 4: 263 |
||
Right | 956432791 | 3:69204360-69204382 | GGAGAGGCTTGGCTTTTTAATGG | 0: 1 1: 1 2: 1 3: 15 4: 171 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
956432788 | Original CRISPR | TCCTGATGTCTTTCCTGTCC TGG (reversed) | Intronic | ||