ID: 956433021

View in Genome Browser
Species Human (GRCh38)
Location 3:69206510-69206532
Sequence GGTTAGAGATTCGGCCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 3, 3: 4, 4: 59}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956433021 Original CRISPR GGTTAGAGATTCGGCCACAG AGG (reversed) Intronic
905280601 1:36846649-36846671 GGTTGGATTTTCAGCCACAGTGG + Intronic
909591558 1:77354706-77354728 GGTTAGAGACTAGGCCACAGTGG - Intronic
1064442283 10:15364512-15364534 GAATAGAGATTCGCCCACACAGG - Intronic
1067552933 10:47247834-47247856 GGTTCGAGCTTCGGCCTGAGGGG + Intergenic
1069916191 10:71788840-71788862 GGTTGGGGATTGGGGCACAGAGG - Intronic
1076919193 10:133442463-133442485 GGTGAGGGCTTCGGCCACACTGG - Intergenic
1078961340 11:16276257-16276279 AGTTAGAGATTCTGCCAGAAAGG + Intronic
1082868551 11:57921303-57921325 GGTCAGAGTTTGGGCCCCAGTGG - Intergenic
1084935550 11:72584761-72584783 AGTTAGTGACCCGGCCACAGAGG + Intronic
1090300858 11:125638063-125638085 GGTTTGAGATGAGGCCAGAGAGG + Intronic
1093155386 12:15678038-15678060 GGCTTGAGATCCGGCCACATGGG - Intronic
1097158356 12:57028666-57028688 GGTTAGAGATCCTCCCACACAGG + Exonic
1098922586 12:76315988-76316010 GGATAGAGACACAGCCACAGAGG + Intergenic
1102119962 12:110432534-110432556 GGTTGGAACTTCTGCCACAGGGG - Intergenic
1103936804 12:124481376-124481398 GGTGTGAGATTCAGCCACAGGGG - Intronic
1109275436 13:60298786-60298808 GGGTAGAGATAGGGCAACAGGGG + Intergenic
1109595282 13:64544897-64544919 GGTTAGAGATTGGGATACATTGG + Intergenic
1124792280 15:32739757-32739779 GGTTAGGGATTCGGACAAGGTGG - Exonic
1126815861 15:52452601-52452623 GGCTAGGGATTTGGGCACAGGGG - Intronic
1128682794 15:69663738-69663760 TGCTAGAGATTGGGCAACAGAGG - Intergenic
1130841297 15:87703613-87703635 GGGCAGCGATTCAGCCACAGAGG - Intergenic
1131788352 15:95937132-95937154 TTTTAGAGATTCAGACACAGGGG + Intergenic
1133224405 16:4333781-4333803 AGAGAGAGATTCGGACACAGAGG - Intronic
1134700021 16:16257465-16257487 GGTTTCAGATTTGGCCACATTGG + Intronic
1135435409 16:22423574-22423596 TGTTAGAGATTCAGCCACTGGGG - Intronic
1139154107 16:64420171-64420193 GGTTAGAGATTTGGAAACTGAGG - Intergenic
1142044605 16:87917383-87917405 TGTTAGAGATTCAGCCACTGGGG - Intronic
1143012921 17:3876145-3876167 GGTTAGAAACTGGGCCACTGCGG + Intronic
1143092627 17:4457968-4457990 GGTTAGAGTTCTGGCCGCAGAGG - Intronic
1153218486 18:2842345-2842367 GGTTAGCGATTCTGGTACAGTGG + Intergenic
1158862910 18:61610553-61610575 TGTTAGAAACTAGGCCACAGAGG - Intergenic
1160557385 18:79735195-79735217 GGTACGAGAAACGGCCACAGAGG - Intronic
1162267100 19:9584591-9584613 GGTTCGAGTTTCAGCCACATAGG + Intergenic
1164934496 19:32200506-32200528 GGTCAGAGCTGAGGCCACAGAGG + Intergenic
1166065516 19:40356221-40356243 GGTGAGAGAGTAGGCCAAAGAGG + Intronic
1166718823 19:44985983-44986005 GCTTAGAGATTCCGCCACCCAGG - Intronic
927900840 2:26817156-26817178 GGTCTGAGCTTCTGCCACAGTGG + Intergenic
928563117 2:32512954-32512976 GGTTAGTGATTCTGCAAGAGTGG + Exonic
933077187 2:77943872-77943894 GGTCAGAGACTTGGGCACAGAGG - Intergenic
937518181 2:122679775-122679797 GGTCAGAACTTAGGCCACAGAGG - Intergenic
942541296 2:177017946-177017968 GGGAAGAGATTTGGGCACAGGGG - Intergenic
1172489212 20:35321067-35321089 GGTTAGAAATTAGCCCACTGTGG + Intronic
1178202240 21:30420714-30420736 AGTTTGAAATTAGGCCACAGAGG - Intronic
949913475 3:8936245-8936267 GGTAAGACATTCAGACACAGGGG + Intronic
950056172 3:10026517-10026539 ACTTAGAGATTAGGCCGCAGGGG - Intronic
956433021 3:69206510-69206532 GGTTAGAGATTCGGCCACAGAGG - Intronic
957273611 3:78062613-78062635 GGTGAGGGAATGGGCCACAGTGG - Intergenic
964729651 3:159851365-159851387 GGTTAGAGTGTGGGCCACAGAGG + Intronic
965944837 3:174227397-174227419 GGTTAAAGAGAAGGCCACAGAGG + Intronic
970291761 4:14580715-14580737 GGTTCCAGATATGGCCACAGAGG - Intergenic
973221190 4:47729866-47729888 AGAGAGAGGTTCGGCCACAGAGG + Intronic
988736316 5:34025155-34025177 GCCTAGAGATTGGCCCACAGAGG + Intronic
992617790 5:78562020-78562042 GGTAAGAGATTCCCCCAAAGAGG + Intronic
994710122 5:103256287-103256309 GGTGAGAGCTGCGGCCATAGAGG - Intergenic
996413925 5:123188989-123189011 GGCTTGAGATTGGGCAACAGAGG - Exonic
997456297 5:134020040-134020062 GGCTAGAGAGTAGGTCACAGGGG - Intergenic
999669603 5:153947267-153947289 GATTAGAGATTCGGCCAAGATGG - Intergenic
1001772392 5:174306037-174306059 GGTTGGAGATTCGGCCAGAGAGG + Intergenic
1004885205 6:20044519-20044541 GCTTAGAGATGCATCCACAGTGG + Intergenic
1011844434 6:91545906-91545928 GGTTAGAGAAGCTGTCACAGAGG + Intergenic
1023025339 7:36044735-36044757 GGTCAGAGTTTCTGCCCCAGGGG - Intergenic
1028868102 7:95736627-95736649 GGGTACAAATTCAGCCACAGTGG - Intergenic
1030085071 7:105808879-105808901 GGTTAGAGCTTCCCCAACAGGGG - Intronic
1045426923 8:102076684-102076706 GGTTAAAGATGCAGCCAGAGAGG - Intronic
1060946308 9:127571129-127571151 GGTTAGAGATGGGGCCACAGTGG + Intronic
1191778931 X:64846444-64846466 GTTTAGAGAGTAGGCTACAGGGG - Intergenic
1195552891 X:106188073-106188095 GGTTAGAGACTCTGCCAATGGGG + Intronic