ID: 956433581

View in Genome Browser
Species Human (GRCh38)
Location 3:69211359-69211381
Sequence TAGTGTAGTACAGTGATGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956433581_956433584 3 Left 956433581 3:69211359-69211381 CCCTGCATCACTGTACTACACTA 0: 1
1: 0
2: 1
3: 3
4: 112
Right 956433584 3:69211385-69211407 ACTGGTTGAAAACAACTTGTTGG 0: 1
1: 0
2: 3
3: 8
4: 153
956433581_956433585 16 Left 956433581 3:69211359-69211381 CCCTGCATCACTGTACTACACTA 0: 1
1: 0
2: 1
3: 3
4: 112
Right 956433585 3:69211398-69211420 AACTTGTTGGCACCCCAGACTGG 0: 1
1: 0
2: 1
3: 17
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956433581 Original CRISPR TAGTGTAGTACAGTGATGCA GGG (reversed) Intronic
907049946 1:51323233-51323255 TAGTGGAGTTTAGTGATGGAGGG - Intronic
910537187 1:88311697-88311719 TAGATTAGTACAGTGCTTCAGGG - Intergenic
913673810 1:121122798-121122820 TAGTGTAGTATAGTGACTAAAGG - Intergenic
914025588 1:143910150-143910172 TAGTGTAGTATAGTGACTAAAGG - Intergenic
914664025 1:149817875-149817897 TAGTGTAGTATAGTGACTAAAGG - Intergenic
914671739 1:149875968-149875990 TAGTGTAGTATAGTGACTAAAGG + Intronic
915533087 1:156515189-156515211 TAATGTATGACAGTGATGCTGGG - Intergenic
915831141 1:159131512-159131534 CAGTTTAGTAGCGTGATGCAAGG + Intronic
919811249 1:201410217-201410239 TAGTGTGGTGCACGGATGCACGG - Intronic
923006380 1:230053401-230053423 TACTGTAGTGCAGTGGTGGATGG - Intergenic
923155479 1:231274808-231274830 TACTGTAGAACAGTGATTAAGGG - Intronic
924404843 1:243731777-243731799 TAGTGAAGTACATTGGTCCATGG - Intronic
1065335354 10:24651638-24651660 TGGTTTAGTCCAGTAATGCAGGG + Intronic
1069664077 10:70143460-70143482 CAGTGTGATACAGTGATGAAGGG - Intronic
1073743912 10:106443861-106443883 AAGGGTAGTAGAGTGATGGAGGG + Intergenic
1078022846 11:7669906-7669928 TAGGGTAGCACAGGGAGGCAGGG - Intronic
1085176823 11:74495116-74495138 TATTGTACTACAGTTTTGCAAGG - Intronic
1086062388 11:82713230-82713252 TAGTTTAATACACTGAAGCAAGG + Intergenic
1086462324 11:87018165-87018187 TAGTGTGGTACTTTGATGGAAGG - Intergenic
1100178078 12:92053303-92053325 CAGTGGGGTACAGTAATGCAAGG - Intronic
1100902217 12:99254275-99254297 AAGTGTAGTCCAGGGATGCTTGG + Intronic
1101074423 12:101113732-101113754 TAGGGTAGTACAGTGATTGCTGG + Intronic
1103163959 12:118754257-118754279 AAGTGTAGTACATGGAGGCATGG + Intergenic
1103588609 12:121974422-121974444 TAGTGGAGGACACTGATGCCAGG + Intronic
1108264467 13:48691357-48691379 TAGGGTGTTACAGTGATGAATGG + Intronic
1109178141 13:59180698-59180720 TATTGTACTACAGTTATGCAAGG + Intergenic
1109398989 13:61799836-61799858 TAGTGTAGTATGGCAATGCATGG + Intergenic
1114842000 14:26274773-26274795 TAGTATAGTACAGTGGTAAAAGG - Intergenic
1115250172 14:31336799-31336821 AACTTTAGTACAGTCATGCATGG + Intronic
1119190893 14:72680973-72680995 GAGTATAGAACAGTGATGAAAGG - Intronic
1121458178 14:94052750-94052772 CAGTGGAGTACAGTGAGGAAGGG - Intronic
1124230635 15:27943226-27943248 GAGTGGGGTACAGTGAGGCACGG - Intronic
1124655212 15:31501901-31501923 TAGTGAGGGACAGGGATGCAGGG - Intronic
1127404402 15:58626218-58626240 TATTGTACTACAGTCTTGCAAGG + Intronic
1127785094 15:62348699-62348721 TATTGTACTATAGTCATGCAAGG - Intergenic
1130764537 15:86856833-86856855 CAGCATAGTACAGTGATGCCTGG - Intronic
1133407100 16:5533500-5533522 GTGTGTATTACAGAGATGCAAGG + Intergenic
1135716669 16:24776143-24776165 TGGAGAAGTACAGAGATGCATGG - Intronic
1141580514 16:84995169-84995191 TAGGGTAGAAGAGTGATGCTGGG - Intronic
1145178360 17:20721902-20721924 TAGTGGGGTACAGGGATGTATGG - Intergenic
1150559436 17:66281983-66282005 TAGTGTTGTCCAGGGATCCATGG + Intergenic
1156760625 18:40584127-40584149 TTCGGTAGCACAGTGATGCAAGG + Intergenic
1157439792 18:47701954-47701976 AAGTGAAGCACAGTGAGGCAAGG + Intergenic
1158449028 18:57547012-57547034 CAGTGGAGTGCAGTGGTGCATGG + Intergenic
1158990297 18:62861943-62861965 TAATGCAATAAAGTGATGCATGG - Intronic
1159829273 18:73253973-73253995 TAGTTTATTTCAGTGTTGCAAGG + Intronic
1160558791 18:79743223-79743245 TGGTATCGTACAGTGAAGCAAGG + Intronic
1165828046 19:38716861-38716883 GAGAACAGTACAGTGATGCAGGG + Intronic
927602220 2:24453868-24453890 AAATGTACTACAGTAATGCAAGG - Intergenic
933800503 2:85956587-85956609 TAGTCTAGTACAGTGACACCAGG - Intergenic
934894833 2:98107162-98107184 TAGTTTACTCCAGGGATGCAAGG - Intronic
935841797 2:107120560-107120582 TAATGCAGTACAGTGAGGAAAGG - Intergenic
939861855 2:147430180-147430202 TTGAGTACTACAGTGATGCCAGG - Intergenic
940237768 2:151529393-151529415 TTGTGTACTATAGTCATGCATGG - Intronic
943748617 2:191488126-191488148 TAAAGTAGGACAGTGAAGCAGGG - Intergenic
947543846 2:230996607-230996629 TCTTGTAGGATAGTGATGCATGG + Intronic
1174480515 20:50828108-50828130 TAGTGGAGAACAGTGGAGCAGGG + Intronic
1174951537 20:55046754-55046776 TACTGAAGTAGAGTGATCCAAGG - Intergenic
1176887745 21:14276152-14276174 TAGTGAAAAACAGTGTTGCATGG + Intergenic
1178056096 21:28799895-28799917 TTGTGTAGTTCAGTGATGAGAGG + Intergenic
1179079067 21:38153362-38153384 TCGTGTCCTACATTGATGCATGG + Intronic
1182538043 22:31020569-31020591 TACTGTAGGCCAGTGATGCAAGG + Intergenic
1185025715 22:48410676-48410698 CAGTGTGGTACAGTGATTCCAGG - Intergenic
954712467 3:52511996-52512018 GAGTGTGGTACAGTGGAGCAAGG - Intronic
955469513 3:59272081-59272103 TAATGTAGTAAAGGGATGAAGGG - Intergenic
956433581 3:69211359-69211381 TAGTGTAGTACAGTGATGCAGGG - Intronic
956484676 3:69709745-69709767 TACTGGAGTAAAGTGATACAAGG + Intergenic
961352397 3:126312222-126312244 CACTGGAGTAGAGTGATGCAAGG + Intergenic
962509181 3:136081700-136081722 TAGGGGAGTACAGTGAGTCAGGG + Intronic
965511822 3:169576035-169576057 TAGATTTCTACAGTGATGCAGGG + Intronic
966930426 3:184672152-184672174 TAGTGGAGTACAGTGGTAAATGG + Intronic
975271950 4:72446122-72446144 TGCTGGAGTACAGGGATGCAAGG - Intronic
976417962 4:84801208-84801230 TACTGTAGTATAGTTATGTAAGG + Intronic
980952053 4:139390370-139390392 TAGTACAGTACAGTGTTTCAGGG - Exonic
981408700 4:144402216-144402238 TAGTGTAGTAAAAGAATGCAAGG + Intergenic
989439710 5:41455999-41456021 TAGTATGGTACAGTGATAGATGG + Intronic
991941863 5:71861116-71861138 CAGTGTAGGACACTGAGGCAAGG - Intergenic
993709141 5:91206221-91206243 TAGTGAAGTACAGTCATGTATGG + Intergenic
995210934 5:109538277-109538299 GAGTTTAGTACAGGGATGTAAGG + Intergenic
996583690 5:125061330-125061352 TAGTGTAGTGTAGTGATTAAGGG + Intergenic
997751415 5:136349791-136349813 AACTGAAGTACAGTCATGCATGG + Intronic
998525947 5:142843333-142843355 GAGTGGAGTTCAGGGATGCAGGG + Intronic
1002687325 5:181024005-181024027 TAGTGCAGTTCAGGGATGCCAGG - Intergenic
1008221683 6:48862262-48862284 TAGTGTAGTGGGGTGATGAAGGG - Intergenic
1008743660 6:54642151-54642173 CGGTGGAGTACAGTGGTGCAAGG + Intergenic
1009198756 6:60719131-60719153 TAGTCTAGGACAGTGTGGCAGGG + Intergenic
1009479678 6:64141014-64141036 AAATGTAGTATAGTGATACATGG - Intronic
1012413664 6:98988814-98988836 TAGTGTGGATCTGTGATGCAAGG - Intergenic
1014972931 6:127841155-127841177 TAGTGTTGTACATTGATGGTGGG + Intronic
1017050349 6:150386802-150386824 TAGTATAGTTATGTGATGCATGG + Intronic
1021523781 7:21563655-21563677 TTGTTAAGTACAGTGATGAAAGG - Intronic
1024042912 7:45568826-45568848 CAGTGCAGAACAGTGATGCTTGG + Intergenic
1025051111 7:55735781-55735803 TAGAGTAATACAGAGATGAAAGG - Intergenic
1026311458 7:69188951-69188973 TAGTATGGTACAGTGATTGAGGG - Intergenic
1027591761 7:80127404-80127426 AAGTGGAGTGCACTGATGCAAGG + Intergenic
1031262135 7:119534088-119534110 AAGTGGAGCACAGGGATGCAAGG - Intergenic
1031691752 7:124797134-124797156 TTGTGTAGTACAGGGCAGCAAGG - Intergenic
1031984390 7:128153816-128153838 GAGTGTAGTGCAGTGATGCAGGG - Intergenic
1032052856 7:128659773-128659795 TAGAGTAATACAGAGATGAAAGG + Intergenic
1033801855 7:144911086-144911108 TACTGAAGTGCAATGATGCATGG + Intergenic
1036008432 8:4693323-4693345 TAATGTGATACAGGGATGCATGG + Intronic
1036531691 8:9595710-9595732 TACTTTTTTACAGTGATGCAAGG + Intronic
1038154792 8:24979097-24979119 TAGTGCAGGACAGTGTTGAATGG + Intergenic
1038904159 8:31879412-31879434 CACTGGAGTCCAGTGATGCAGGG + Intronic
1041745718 8:61207272-61207294 AAGTGAAGTTCAGAGATGCACGG + Intronic
1050736679 9:8771494-8771516 CAGTGTAGTATAGTGACACACGG + Intronic
1054871762 9:70053672-70053694 AAGAGTAATACAGAGATGCAAGG + Intronic
1058580518 9:106451411-106451433 CAGTGTTGTACAGTGCTGAATGG + Intergenic
1058808928 9:108620258-108620280 TATTGTAGAACTGTGCTGCATGG - Intergenic
1059245783 9:112848626-112848648 TTGTGCTGTCCAGTGATGCAGGG + Intronic
1059803869 9:117777544-117777566 TTGTTTATTTCAGTGATGCAGGG + Intergenic
1186618044 X:11210265-11210287 GGATGTACTACAGTGATGCAAGG - Intronic
1187445997 X:19361712-19361734 TAGCGTGGTTCAGTGATACAGGG - Intronic
1192751271 X:73994544-73994566 TAGTGTACTACAGTTTTACAAGG - Intergenic
1193824775 X:86210126-86210148 TAGTGCAGTGCAGTGAAGAATGG + Intronic
1197768283 X:130072933-130072955 TGGTGTGGTACAGTGAGGGAAGG - Intronic
1198319087 X:135500936-135500958 GAGTGTACTCCAGAGATGCAAGG - Intergenic