ID: 956435067

View in Genome Browser
Species Human (GRCh38)
Location 3:69227043-69227065
Sequence GAGAAAAATACCACCTGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956435065_956435067 6 Left 956435065 3:69227014-69227036 CCTAAAGAAATAGCTGTGTGTTT 0: 1
1: 0
2: 3
3: 32
4: 385
Right 956435067 3:69227043-69227065 GAGAAAAATACCACCTGTGTTGG 0: 1
1: 0
2: 0
3: 19
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956435067 Original CRISPR GAGAAAAATACCACCTGTGT TGG Intronic
902213727 1:14922005-14922027 GAAAAAAATAGCACCTGGCTGGG - Intronic
903391446 1:22966408-22966430 GGGAGAAATACCACGTTTGTAGG - Intergenic
904028062 1:27517353-27517375 GAGAAAAGGAACATCTGTGTTGG + Intergenic
906305657 1:44717234-44717256 GAGAAAAATGCCTGCTGTATCGG + Intronic
906472532 1:46143141-46143163 GAGAAAAATACTACCAATGAAGG - Intronic
909330631 1:74405788-74405810 GAGAATAATAACACCTCAGTTGG - Intronic
909515222 1:76499468-76499490 GATAAAAAGACCAGCTGTGGAGG - Intronic
909879166 1:80850773-80850795 GAGGAAAATAACTCCTGTGTTGG - Intergenic
911893147 1:103398135-103398157 GAGAAAATGGCCTCCTGTGTGGG + Intergenic
911952029 1:104185336-104185358 AAGAAAAAAACAACCTGTTTGGG - Intergenic
912024218 1:105146710-105146732 GAGAAAAATAGCAGGAGTGTTGG + Intergenic
916012322 1:160717497-160717519 GAGAAGAAAACCACATATGTGGG - Intergenic
917104176 1:171475734-171475756 GAGAGAACCACCACCTGTGGTGG - Intergenic
917262966 1:173189705-173189727 AATAATAATAACACCTGTGTGGG + Intronic
918293919 1:183136902-183136924 GAAATAAATACCACCTGTCTAGG - Intronic
919120486 1:193334218-193334240 GAGACAGATACCACCTGCTTAGG - Intergenic
919531221 1:198723832-198723854 GAGAATGAGACCACATGTGTAGG + Intronic
920730347 1:208477536-208477558 CAGGAAAATACCACCTGGCTGGG - Intergenic
923723071 1:236483765-236483787 GGGAAAGATGCCACCGGTGTGGG + Intronic
1063239689 10:4155295-4155317 GAGAAATATTCCACATGTGTGGG - Intergenic
1063868847 10:10396753-10396775 GGGAAAAATACATCATGTGTGGG + Intergenic
1064843182 10:19619244-19619266 GAAAAAAACATCACCTATGTTGG - Intronic
1070404365 10:76081641-76081663 GAGCAGAATACCACTTGTATAGG - Intronic
1070528519 10:77316002-77316024 GAGGAAAATATCTCCAGTGTGGG + Intronic
1071227517 10:83547749-83547771 GAGAACAGTATCACATGTGTTGG + Intergenic
1076805198 10:132852546-132852568 GAGAAACATACCACGTCTGTGGG - Intronic
1077308936 11:1880029-1880051 GTGCAAAACAGCACCTGTGTCGG + Intronic
1078526575 11:12106016-12106038 GAGAAAAATGGCACCTGTCTGGG - Intronic
1078765202 11:14289951-14289973 TAGAAAAAAACAAGCTGTGTCGG + Intronic
1079702820 11:23570231-23570253 GAGAAAAATACCCACTGTCATGG + Intergenic
1081074307 11:38650391-38650413 GAGAAAAATAACATCTTGGTTGG + Intergenic
1084420274 11:69057231-69057253 TAGAAAAATACCAGCTCAGTGGG - Intronic
1085096351 11:73763396-73763418 GGGAACAGTACCACCTGTCTAGG - Intergenic
1085259681 11:75197290-75197312 GAGACACATCCCACCTGGGTGGG + Intronic
1087895647 11:103582991-103583013 GAGAAAAATAGCACTTGAGTTGG + Intergenic
1087958613 11:104320505-104320527 GAAAGAAATTCCACTTGTGTTGG + Intergenic
1088570538 11:111219350-111219372 GAGAAAAATACCTACTTTTTGGG - Intergenic
1089081555 11:115780490-115780512 GACAAAAATACTACCTTTGAGGG - Intergenic
1089931077 11:122312909-122312931 GAGAAAAATACTACTAGTCTTGG + Intergenic
1089945090 11:122462172-122462194 GAGAAACAAACCATCTGGGTGGG - Intergenic
1091875142 12:3927562-3927584 GAGACTAATACCAAATGTGTGGG - Intergenic
1092138942 12:6169455-6169477 GAAAAAAATTGCACCTGTGTAGG - Intergenic
1092244033 12:6852968-6852990 GAGAAAGAAACCACCTCTCTAGG - Intronic
1094049745 12:26205888-26205910 GAGACAAAGCCAACCTGTGTGGG - Intronic
1094462483 12:30712037-30712059 AAGACCAATACCAACTGTGTTGG + Intronic
1094685499 12:32709792-32709814 GAGAAATATACAACCTAAGTAGG + Intronic
1095162095 12:38930907-38930929 GAAAAAAATAATCCCTGTGTTGG + Intergenic
1097088999 12:56490308-56490330 GAGAAAAATACCATCTGTTAGGG + Intergenic
1098334389 12:69387685-69387707 TAGAATGATACCACTTGTGTTGG + Intronic
1099517732 12:83619007-83619029 AAGTAAAATACCACCTGAGTAGG + Intergenic
1099726973 12:86443514-86443536 GAAAACAATAGCCCCTGTGTAGG + Intronic
1099980695 12:89598616-89598638 GAGGAAAACACTACATGTGTAGG + Intronic
1100014425 12:89991694-89991716 GAGAAAAAGACTGCCTGTGTTGG - Intergenic
1100403146 12:94249911-94249933 GAGAAAAAAAGCACCAGTGTGGG + Intronic
1101492009 12:105218446-105218468 AAGAAAAATACTGGCTGTGTTGG + Intronic
1101831531 12:108261710-108261732 GAGTAAAATACCATCGGTTTCGG - Intergenic
1102415078 12:112754527-112754549 AAGGAAAAGACCACATGTGTAGG + Intronic
1103181312 12:118914397-118914419 GTGAGAAAACCCACCTGTGTTGG + Intergenic
1103327653 12:120132056-120132078 GGGAACAACACCAGCTGTGTGGG + Intronic
1103419430 12:120768478-120768500 GAGAAAAATACCTGCCGAGTTGG + Exonic
1104201254 12:126591570-126591592 GAGAAAAAGAAAACCTTTGTGGG - Intergenic
1107017009 13:35715570-35715592 GAGAATAATACCACTCCTGTAGG + Intergenic
1107304024 13:38998972-38998994 GATAAAAATAGCACATGTGCAGG - Intergenic
1109389564 13:61675330-61675352 GAGAAATTTAGCAGCTGTGTTGG + Intergenic
1111309835 13:86470404-86470426 GAGAAAATTCCCACATTTGTAGG - Intergenic
1113086418 13:106573853-106573875 GAAAAAAATACCTCCTGACTAGG + Intergenic
1113126984 13:106990255-106990277 GAGAAAAATAAGCCCAGTGTGGG + Intergenic
1114777365 14:25498954-25498976 GAAATAAATACCAGCTGTGCAGG - Intergenic
1115031350 14:28798599-28798621 GAGAAATATAACAACTGTTTTGG - Intronic
1116582370 14:46658844-46658866 GAGAAGAATACCACTTAGGTAGG - Intergenic
1117843395 14:59884801-59884823 GAGAAAAATAACACTTGTTTGGG - Intergenic
1124894956 15:33767693-33767715 GAGAAAAAAGCCACCTGGATAGG - Intronic
1125435132 15:39636263-39636285 GAGAAAAATACCACTTTAGATGG - Intronic
1126579316 15:50228437-50228459 GTGAAAAATAGCACCTGGTTGGG + Intronic
1130206683 15:81881982-81882004 AGCAAAAATAACACCTGTGTAGG + Intergenic
1130796855 15:87218726-87218748 GATAAATATATCATCTGTGTTGG - Intergenic
1131660162 15:94505556-94505578 GAGACTGATACCACCAGTGTTGG - Intergenic
1132328617 15:100994714-100994736 GCTAAAAATACCACCTGCTTTGG - Intronic
1137442769 16:48510625-48510647 GGGAATAATACCACCTATCTTGG - Intergenic
1137779093 16:51081965-51081987 GGAGAAAATACTACCTGTGTAGG + Intergenic
1139069800 16:63366272-63366294 GAAAAAAATACCACTTGTCCAGG + Intergenic
1139112303 16:63905394-63905416 GAGAAAAATATCCTCTGTTTGGG - Intergenic
1139260196 16:65584454-65584476 TAGAAAAATAACTTCTGTGTTGG - Intergenic
1140883492 16:79220774-79220796 GAGATAAAAGCCATCTGTGTAGG - Intergenic
1142824015 17:2496167-2496189 GATAAAAATACTATTTGTGTAGG - Intronic
1143346718 17:6254917-6254939 GACATAAATACCACATGTGCAGG + Intergenic
1144280392 17:13720496-13720518 GAGAAAAAGGCCACAGGTGTGGG - Intergenic
1144721584 17:17474668-17474690 CAGAAAAATACTGCCTGTGCTGG - Intergenic
1145201525 17:20949605-20949627 TAGACACATTCCACCTGTGTAGG - Intergenic
1145983389 17:29027695-29027717 GAGCAGAATGCCACCTCTGTGGG - Intronic
1146581827 17:34045224-34045246 GGGAATATTACTACCTGTGTTGG - Intronic
1146957490 17:36944369-36944391 CACAAAAATAAAACCTGTGTGGG - Exonic
1149284865 17:55151109-55151131 CAGAACAATAAGACCTGTGTGGG + Intronic
1149852777 17:60050398-60050420 AAGACAAATACCATATGTGTTGG + Intronic
1153767020 18:8384606-8384628 GAGACAAATTCCACCTGGATGGG - Exonic
1158163899 18:54517541-54517563 GAGAAAATTACCACAGGTTTGGG - Intergenic
1159357128 18:67350676-67350698 GAGAATAATAGCACTTGTGCAGG - Intergenic
1160431168 18:78813540-78813562 GAGATAAATACCAACTCTGAGGG + Intergenic
1162101955 19:8344077-8344099 GAGAAAAATACTAACTGGGGAGG - Intronic
926343382 2:11923391-11923413 TAGAAAAAAACCAGCTGTGATGG - Intergenic
933890806 2:86767763-86767785 TAGAAAACTACTACCTGTTTTGG + Intronic
934609510 2:95724216-95724238 CAGAAAAAGCCCACCTGTCTAGG - Intergenic
936542832 2:113365794-113365816 CAGAAAAAGCCCACCTGTCTAGG - Intergenic
942083370 2:172422535-172422557 TATAAAAATATCTCCTGTGTTGG - Intergenic
943309825 2:186311428-186311450 GAGAGAAATTCCACTTGTTTGGG + Intergenic
943956412 2:194197373-194197395 GAGACACATGCCACCTGTGAGGG + Intergenic
945512375 2:210718611-210718633 CAGAAATATAGCACCTGTCTTGG + Intergenic
1170573180 20:17643873-17643895 GAGAACAAAACCATGTGTGTGGG - Intronic
1172560782 20:35886568-35886590 GACAAGAATAGCAACTGTGTTGG + Intronic
1175480153 20:59304983-59305005 GAGAAAGAGGCCTCCTGTGTGGG - Intronic
1175850662 20:62090405-62090427 GATAAAAAGGGCACCTGTGTAGG - Intergenic
1177024507 21:15905540-15905562 GAGAAAAATACCACTGAAGTAGG - Intergenic
1181557104 22:23677466-23677488 GTGATAAATACTACCTGTGGAGG - Intergenic
1181697269 22:24600073-24600095 GTGATAAATACTACCTGTGGAGG + Intronic
1184834020 22:47010034-47010056 GAGAATGGTTCCACCTGTGTGGG + Intronic
950145245 3:10645069-10645091 GAAAAAAATACTACGTATGTCGG + Intronic
950243127 3:11389560-11389582 CGGGAAAATACCGCCTGTGTGGG + Intronic
951379277 3:21963220-21963242 GAGAAGTTTATCACCTGTGTAGG + Intronic
953148629 3:40303814-40303836 AAGAAAAATACCACGATTGTAGG + Intergenic
953411811 3:42694681-42694703 GAGACACAAACCAACTGTGTGGG - Intronic
954275213 3:49537514-49537536 GAAAAGAATACCACCAGTCTTGG + Intergenic
954882022 3:53843017-53843039 CTGGAAAATTCCACCTGTGTGGG + Intronic
955433364 3:58872729-58872751 GAGAAAGATAACCCTTGTGTTGG - Intronic
956410153 3:68970780-68970802 GAGAATAATACCTGCAGTGTTGG + Intergenic
956435067 3:69227043-69227065 GAGAAAAATACCACCTGTGTTGG + Intronic
956758728 3:72417504-72417526 GGGAGATATACCACATGTGTGGG + Intronic
960524951 3:118699031-118699053 TGGAAAAATACCACCTGTATGGG - Intergenic
960638204 3:119804428-119804450 AAAAAAAATACCAACTATGTTGG - Intronic
960934100 3:122885972-122885994 GAGAAAAAGAGCACTGGTGTAGG + Intergenic
966436254 3:179887662-179887684 GAGAGAATTACCAGCTGTATTGG + Exonic
971931789 4:33093315-33093337 GAGAAAAATAGCAGTTGTGAAGG + Intergenic
972733606 4:41818773-41818795 GAGAAAAATACAATCTCTGTGGG + Intergenic
973737993 4:53891331-53891353 GAGAGAGTTACCAACTGTGTCGG + Intronic
974120776 4:57635536-57635558 AATAAAAATTCCACCTGTGTGGG - Intergenic
974711425 4:65601640-65601662 GAGAAAAATGGCACCTGTCAAGG - Exonic
978630416 4:110737838-110737860 GAGAGAAAAACCACTTTTGTGGG - Intergenic
981274825 4:142886639-142886661 GAGAGACATACCACCTTTGCCGG + Intergenic
982284542 4:153721459-153721481 GATGAAGCTACCACCTGTGTTGG - Intronic
982633130 4:157857785-157857807 AAGAAAACAACCACCTGTGATGG + Intergenic
985436422 4:189934294-189934316 GAGAAATAAACCAAATGTGTTGG - Intergenic
989269887 5:39520631-39520653 GAGAAAAATATCCTCTTTGTTGG + Intergenic
989632783 5:43503747-43503769 CACAAAAATTCCACCTGTGAAGG + Exonic
993533905 5:89057275-89057297 GAAAAAAATCACATCTGTGTCGG + Intergenic
995454331 5:112335854-112335876 GAGAGAAACACCAGCTGTGATGG - Intronic
995757497 5:115524669-115524691 GACAAGAATACTACATGTGTAGG - Exonic
996240458 5:121193975-121193997 GAAAAAAATATGACCTGTGTTGG - Intergenic
999719881 5:154391819-154391841 GAGAAAAAGCCCACCTGAGAGGG - Intronic
1001498761 5:172211670-172211692 GTGAAAAATTCCATCTGTGATGG - Exonic
1003436409 6:6092599-6092621 GACAAAAATGCCACCAGTTTAGG + Intergenic
1004028667 6:11844495-11844517 TAGAAAAATATAAACTGTGTAGG - Intergenic
1006173937 6:32110511-32110533 GAGAAATATCCCAGCTGAGTGGG + Intronic
1007147760 6:39653788-39653810 GAAAAAAATCCCAACTCTGTAGG + Intronic
1013336065 6:109163718-109163740 AAAAAAAATACCACTTTTGTGGG - Exonic
1014605602 6:123470349-123470371 AAGAATAATAACATCTGTGTTGG + Intronic
1014914789 6:127133387-127133409 GAGAAAAATCCCACCTTAGGAGG + Intronic
1015052345 6:128857030-128857052 GAGAAAAATTCTAGTTGTGTTGG + Intergenic
1016241379 6:141935227-141935249 GAGAAAAAGAGCACATGTGCAGG - Intergenic
1020270706 7:6593627-6593649 CAGAAAAACACCACCTGACTGGG - Intronic
1020604934 7:10325287-10325309 GAGAAAAATACCAACAAAGTTGG + Intergenic
1021594533 7:22301025-22301047 GGGAAAACTCACACCTGTGTAGG + Intronic
1021805081 7:24347500-24347522 GAGAAAAATGCCACTGATGTAGG - Intergenic
1023247202 7:38217602-38217624 GAGAAAAGAACAACCTGTCTGGG - Intronic
1026243164 7:68594842-68594864 GAGAAAAGGACCACCTAGGTTGG - Intergenic
1026343136 7:69451387-69451409 AAGAAAAGTACCACCTGGCTGGG + Intergenic
1027731901 7:81885028-81885050 CAGGAAATTACTACCTGTGTGGG + Intergenic
1027927704 7:84488227-84488249 GAGAGACATACCACATATGTAGG + Intronic
1030212187 7:107007423-107007445 GAGAAAAATAGCAGCTCTGAAGG - Intergenic
1030389614 7:108910331-108910353 GAGAATAAAACCAACTGTGTCGG - Intergenic
1030710968 7:112748462-112748484 AAGAAAAATACCAGCTATGCAGG - Intergenic
1031029014 7:116714475-116714497 GAAAAAAATAAGATCTGTGTGGG - Intronic
1035244110 7:157551323-157551345 GTGAAAAATACCACAACTGTAGG + Intronic
1037106943 8:15120356-15120378 GGGGAAAATACTACCTGTATAGG - Intronic
1037164334 8:15808844-15808866 TAAAAAAAGACAACCTGTGTAGG - Intergenic
1040886599 8:52270052-52270074 TAGAAAAATATTACATGTGTCGG - Intronic
1047158980 8:122355123-122355145 GAGAAAGATATTACCTGTGTTGG - Intergenic
1048551842 8:135440754-135440776 AAGAAAAATAACACCTTTTTTGG + Intergenic
1050626769 9:7512263-7512285 GAGATAAAAACCACCTTTGAGGG + Intergenic
1051374800 9:16392106-16392128 GAGAAATATAGCACCTGCTTGGG + Intergenic
1052199360 9:25759063-25759085 GAGAAAAATGCTACCTATATAGG + Intergenic
1052637073 9:31120171-31120193 GTGAAAGATACTGCCTGTGTAGG + Intergenic
1053907639 9:42859862-42859884 GAGGAAACTGCCACCTGTATTGG + Intergenic
1054707990 9:68482413-68482435 GAGAAAAAAACACCTTGTGTAGG + Intronic
1054742904 9:68826731-68826753 AAGAGAAATACCACTTGTCTTGG - Intronic
1055077778 9:72234579-72234601 CAGAAAAAAACCCCATGTGTTGG - Intronic
1057327586 9:94079977-94079999 GAGCCAGATAACACCTGTGTGGG + Intronic
1185690519 X:2151466-2151488 CAGAAAAGATCCACCTGTGTGGG + Intergenic
1187483128 X:19676336-19676358 GATAAAAAGACTACCTGGGTGGG + Intronic
1188408321 X:29839727-29839749 GAGACAAATTCTCCCTGTGTTGG - Intronic
1191204158 X:57816710-57816732 GAGAAAAACCCCACATGTGGTGG + Intergenic
1192027144 X:67465937-67465959 CAGAATATTACCACCTGTGGTGG + Intergenic
1192309042 X:69994215-69994237 GAAGAAAATATCACTTGTGTAGG - Intronic
1195955244 X:110321767-110321789 GATAAAAATAACACTTGTTTGGG - Intronic
1196991678 X:121336078-121336100 GAGAAAAATACCACCTTCCTAGG + Intergenic
1197098372 X:122622268-122622290 GAGAAAAATAGGAACTGTCTTGG + Intergenic
1197357724 X:125457130-125457152 GTGAAATATACCATCTATGTTGG - Intergenic
1198093772 X:133357538-133357560 GAAAAAAATACCAGATGTGATGG - Intronic
1199361960 X:146931165-146931187 AAGAAAAATAGCAACTGTATAGG - Intergenic