ID: 956435707

View in Genome Browser
Species Human (GRCh38)
Location 3:69232664-69232686
Sequence GCAGGTGCACCCATTTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956435707_956435712 -6 Left 956435707 3:69232664-69232686 CCCCAGCAAATGGGTGCACCTGC 0: 1
1: 0
2: 2
3: 12
4: 120
Right 956435712 3:69232681-69232703 ACCTGCTTGTGGCTAATTGTGGG 0: 1
1: 0
2: 0
3: 3
4: 96
956435707_956435711 -7 Left 956435707 3:69232664-69232686 CCCCAGCAAATGGGTGCACCTGC 0: 1
1: 0
2: 2
3: 12
4: 120
Right 956435711 3:69232680-69232702 CACCTGCTTGTGGCTAATTGTGG 0: 1
1: 0
2: 0
3: 12
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956435707 Original CRISPR GCAGGTGCACCCATTTGCTG GGG (reversed) Intronic
900502713 1:3014360-3014382 GCCGATGCACCCATGTCCTGGGG - Intergenic
903260022 1:22126570-22126592 AGAGGAGCCCCCATTTGCTGAGG - Intronic
908878120 1:68700728-68700750 GAGGGTGCACTCATTTGCTAGGG + Intergenic
910536249 1:88301069-88301091 CCACGTGCACCCATTTTCTTTGG - Intergenic
912465325 1:109868832-109868854 GCAGGTTCACACCTTGGCTGTGG + Intergenic
913060415 1:115199844-115199866 GTTGGTGCAGTCATTTGCTGGGG + Intergenic
914786407 1:150836325-150836347 TCAGGTGCACCCAGATGATGTGG - Exonic
921202709 1:212822655-212822677 GCAGCTGCACCCATTTTCAGAGG + Intergenic
923104127 1:230841353-230841375 GCACGTGCAGCCATCTGCCGAGG + Intronic
1064719839 10:18217868-18217890 GCAGGGGCAAGCATTTCCTGGGG - Intronic
1067046518 10:42988376-42988398 GCAGGGTCACCCAGATGCTGGGG + Intergenic
1068423160 10:56822180-56822202 TCAGGTGCACCTTTTTCCTGTGG - Intergenic
1069851271 10:71406552-71406574 GCAGGGGCCCCCATTAGCCGAGG - Intronic
1069886386 10:71626556-71626578 GCAGCTGCACCCACTCTCTGGGG - Intronic
1069930605 10:71878994-71879016 CCAGGTGCAGCCATGTGCGGTGG - Intergenic
1070551129 10:77491553-77491575 GCAGTGGCTCCAATTTGCTGAGG + Intronic
1072448224 10:95517891-95517913 GCATGTGCACCCATTGGAAGAGG - Intronic
1072539095 10:96384821-96384843 GCAGGTGCAGCAGTGTGCTGGGG - Intronic
1072611189 10:97018618-97018640 GCAGGTGCCCCCATTTTCACAGG + Exonic
1077390018 11:2296532-2296554 GGACCTGCAGCCATTTGCTGGGG - Intronic
1080712972 11:34769324-34769346 GCAGGTGCTTGCAGTTGCTGTGG + Intergenic
1090953434 11:131494501-131494523 CCAATTGAACCCATTTGCTGGGG + Intronic
1097993165 12:65858019-65858041 GGAGGTGCAGGCATTTCCTGAGG + Exonic
1101111578 12:101491665-101491687 GCATGTGCACCCACCTGCTAAGG + Intergenic
1102577650 12:113866553-113866575 CCAGGTTCACCCAGTTGGTGAGG - Intronic
1102681682 12:114694870-114694892 GGAGGTGCCCCAATTTGCAGGGG + Intergenic
1104112491 12:125716963-125716985 GCAAGTGCACTGATTTGCTGGGG + Intergenic
1104681485 12:130754996-130755018 CCTGCTGCACCCATTTTCTGGGG - Intergenic
1105634436 13:22203710-22203732 CCAGGTGCTTCCATTTGCTGAGG + Intergenic
1105638171 13:22236283-22236305 ATAGGTAAACCCATTTGCTGGGG + Intergenic
1106037426 13:26056795-26056817 GCAGGTGCACCAATTTTGAGAGG + Intergenic
1108058082 13:46505140-46505162 GAAGGTGCACCCTTCTCCTGGGG - Intergenic
1111040882 13:82745829-82745851 GCAGAAGTACACATTTGCTGAGG - Intergenic
1111627645 13:90809957-90809979 GCAGTTGGACCTATTTGCTTTGG - Intergenic
1111659137 13:91187569-91187591 ACAGCTGAAACCATTTGCTGGGG + Intergenic
1113160372 13:107373548-107373570 ACAGCTGGACCCATTGGCTGTGG - Intronic
1114587885 14:23831524-23831546 GCAGGTGCACTTATTTGATGTGG + Intergenic
1118297194 14:64581391-64581413 GCCAGTGGACCCATTTGGTGGGG + Intronic
1120645510 14:87069663-87069685 GCAGGTACAGCCTTTTCCTGAGG + Intergenic
1120867482 14:89308410-89308432 GCAGATGCACGCACTTGCTGTGG + Intronic
1123014034 14:105365103-105365125 GCAGCTCCAGCCCTTTGCTGAGG + Intronic
1128112596 15:65086001-65086023 TCTGGTGCATACATTTGCTGTGG + Intergenic
1129153247 15:73702397-73702419 GCTGGTGCACAGCTTTGCTGAGG + Exonic
1129725139 15:77897827-77897849 CCAGGTGCAGCCCTGTGCTGCGG - Intergenic
1132285327 15:100658401-100658423 ACAGGGGCACCCATGTGCGGCGG - Intergenic
1133744135 16:8674509-8674531 GCGGGCGCACCCATTGGCTGTGG + Intergenic
1135631308 16:24037791-24037813 GGAGGTGTATCCATTTGCTGTGG + Intronic
1143663846 17:8344954-8344976 GCAGGTGCAACCAGATGGTGAGG - Intronic
1146544389 17:33725679-33725701 GCAATTGCATCCATATGCTGAGG - Intronic
1148155086 17:45418989-45419011 GCAGGAGTACCCACTTGGTGGGG - Intronic
1151977967 17:77492979-77493001 GGAGATGATCCCATTTGCTGTGG + Exonic
1153929067 18:9862634-9862656 GCAGGTGCACACATTTCCCTGGG - Intergenic
1160322992 18:77913968-77913990 GCAGGTGCACCTGGCTGCTGGGG + Intergenic
1160531523 18:79567760-79567782 GCCTGTGCACACATTTGCTCCGG + Intergenic
1164890702 19:31820854-31820876 GCAGGTTCATCCATGTGCTAGGG + Intergenic
1165247346 19:34505103-34505125 GCATGTGCACACATTTCATGGGG + Exonic
1168421952 19:56210217-56210239 ACAGGTGCACCGCTCTGCTGGGG - Intergenic
1168423509 19:56220533-56220555 ACAGGTGCACCACTCTGCTGGGG + Exonic
1168427263 19:56248839-56248861 ACAGGTGCACCGCTCTGCTGGGG - Intronic
929094113 2:38247613-38247635 GCACTTACACCCATTTGCTTGGG + Intergenic
930147454 2:48021890-48021912 GAAGGTTCATCTATTTGCTGGGG - Intergenic
936427795 2:112435019-112435041 GCAGGGGGAGCCACTTGCTGGGG - Intergenic
937753881 2:125512951-125512973 GCAGGTTCACCCAGTTTCTATGG - Intergenic
939081346 2:137665201-137665223 CCAGGTTCACCCATTGCCTGTGG + Intronic
940577081 2:155522608-155522630 GAAAATGCAGCCATTTGCTGAGG + Intergenic
948276672 2:236714302-236714324 GGAGGTGCATTCATTTTCTGAGG - Intergenic
948887511 2:240891563-240891585 CCAGGTCCACCCCTTGGCTGAGG + Exonic
1168767944 20:394906-394928 GCAGGTGAAGTCATTTGCTCAGG - Intronic
1170004501 20:11651181-11651203 CCAGGTGCACCCAGTCTCTGAGG - Intergenic
1171243131 20:23587462-23587484 GCAGGTACACCCCTGTGGTGTGG + Intergenic
1173626408 20:44476090-44476112 CCAGGTGTCCCCATTTCCTGGGG - Intronic
1173845980 20:46189089-46189111 GCAGGTGCAGCCACCTCCTGGGG + Intronic
1174451528 20:50623744-50623766 GCAGGTGCCCCCAGTTACTTAGG - Intronic
1175720448 20:61282846-61282868 GCATTTGCACGCATGTGCTGTGG + Intronic
1176374449 21:6080192-6080214 GCAGGGGGAGCCACTTGCTGGGG + Intergenic
1178163470 21:29945699-29945721 GCAGGTGCATGCATCTGCTAAGG + Intergenic
1178408747 21:32347083-32347105 AGAGCTGCACCCACTTGCTGTGG - Exonic
1178712224 21:34927833-34927855 GCTGGTCCATCCATTAGCTGTGG - Intronic
1179749026 21:43458053-43458075 GCAGGGGGAGCCACTTGCTGGGG - Intergenic
1182920461 22:34074527-34074549 TCAGGTGCGCCCAGGTGCTGGGG + Intergenic
1183584657 22:38745954-38745976 GCAGGTGCCCCCATTCTCTGAGG + Intronic
1184456747 22:44615227-44615249 GCAGCTGGAGCCCTTTGCTGGGG - Intergenic
956435707 3:69232664-69232686 GCAGGTGCACCCATTTGCTGGGG - Intronic
956470027 3:69556773-69556795 GCAGTTGCACCCATTAGGTCAGG - Intergenic
956690703 3:71875566-71875588 GCAGCTGCTGCCATCTGCTGGGG - Intergenic
957910576 3:86616367-86616389 CCAGGTGCATTCATTTGCTAGGG - Intergenic
958263690 3:91412393-91412415 GCAGGGGTACCCATTTTCTTTGG + Intergenic
960502716 3:118456444-118456466 CCAGGTACACCCACTTGCAGAGG - Intergenic
961074338 3:123967706-123967728 GCAGGTGCAGCCCAGTGCTGTGG + Intergenic
962095900 3:132292474-132292496 GCCGGTGGACCCAGCTGCTGGGG - Intergenic
966100795 3:176267324-176267346 TCAGGTGCACCTCTCTGCTGAGG + Intergenic
968735732 4:2295720-2295742 GCAGGCGCTGACATTTGCTGAGG - Intronic
970028455 4:11649430-11649452 GAAGGTGTATTCATTTGCTGGGG - Intergenic
983810063 4:172050602-172050624 GCCAGTGGACCCATTTGGTGTGG + Intronic
987425594 5:17769123-17769145 TGAGGTGAACCCATTTGCTAAGG - Intergenic
989536680 5:42572306-42572328 GAAGGTGCACCCTTTTGTTGTGG - Intronic
991174203 5:63667842-63667864 GCAGGTGCAACCATGTGCAGAGG + Intergenic
992302827 5:75402116-75402138 GCAGTTACACCCAGCTGCTGTGG - Intronic
994811864 5:104529478-104529500 TCAAGTGTACCCATTTGTTGAGG - Intergenic
1000001038 5:157139400-157139422 GGAAGTGCACTCACTTGCTGTGG + Exonic
1002101715 5:176861170-176861192 GGGGGTGCAGCCCTTTGCTGTGG + Intronic
1002377927 5:178801554-178801576 TCAGATGTACCCATTTGCTCTGG + Intergenic
1006372410 6:33653446-33653468 ACACATGCACCCATTTGGTGTGG + Intronic
1008991740 6:57610579-57610601 GCAGGGGTACCCATTTTCTTTGG - Intronic
1021551897 7:21879711-21879733 GCAGGGGCACCCATCAGCTTGGG - Intronic
1022812449 7:33883440-33883462 ACAGGCCCACCCCTTTGCTGTGG - Intergenic
1023493560 7:40769783-40769805 GCAGGTGTATTCATTTCCTGTGG - Intronic
1027159429 7:75791513-75791535 CCAGGAGCCCCCATCTGCTGTGG + Intergenic
1029414222 7:100432993-100433015 TCAGATGCACCCACTTGGTGAGG - Exonic
1034328045 7:150255646-150255668 GCAGGAGAAACCATTTGCAGTGG + Intronic
1034562640 7:151891225-151891247 CCAGGAGCACGCACTTGCTGTGG - Intergenic
1034765170 7:153713801-153713823 GCAGGAGAAACCATTTGCAGTGG - Intergenic
1034892785 7:154855456-154855478 GCAGGTGAACCTTTTTGCTGGGG - Intronic
1035332915 7:158107945-158107967 GCAGGTGCATCAAGTTGCAGTGG - Intronic
1041369326 8:57142852-57142874 GCAGGTGCACTGGGTTGCTGAGG - Intergenic
1045064626 8:98434603-98434625 GCAGATGCAGTCATTTGCTTGGG - Intronic
1046442151 8:114271046-114271068 GAAGTTGCACCCATTAACTGTGG - Intergenic
1047923560 8:129659284-129659306 GCAGGAGCAAACATTAGCTGGGG - Intergenic
1048960071 8:139569086-139569108 GAAGATGCAGCCATTTGCTCTGG + Intergenic
1049422074 8:142521428-142521450 GCAGGTGCAGCCTTTGGCTGGGG + Intronic
1050757242 9:9020571-9020593 GCACGTGCTGCCATTTTCTGAGG + Intronic
1050808159 9:9709377-9709399 ACATGTGCACTCTTTTGCTGTGG + Intronic
1054805514 9:69393113-69393135 GCAGCTCCACCCCTTAGCTGCGG - Intergenic
1055039814 9:71857314-71857336 GCACTTGCTCTCATTTGCTGTGG + Intergenic
1057142528 9:92735966-92735988 ACAGCAGCACCCATTAGCTGTGG + Intronic
1057412506 9:94829580-94829602 GCAGCTGCAGCCAGCTGCTGAGG - Intronic
1057525900 9:95800924-95800946 ACAGGTGTCCCCATTTGATGGGG - Intergenic
1060416607 9:123435134-123435156 GCAGGTGCTCCCATGTTCTCAGG - Intronic
1060753251 9:126189079-126189101 GCTAATGCACCCATTTCCTGAGG - Intergenic
1062119668 9:134827539-134827561 GCAAGGCCACCCATTTGCAGAGG - Intronic
1062394966 9:136349115-136349137 GCAGGTGCAGACACTGGCTGGGG + Intronic
1187397034 X:18927745-18927767 GCTGATGTTCCCATTTGCTGAGG - Intronic
1193836177 X:86347370-86347392 GCAAGTGCACCCATGTGCTGAGG - Intronic
1195734806 X:108001166-108001188 TTAGGAGCACCCATTTGCCGGGG + Intergenic
1199849024 X:151712058-151712080 CCAGGTGCACCCATTTGCTTGGG + Intergenic