ID: 956440945

View in Genome Browser
Species Human (GRCh38)
Location 3:69279811-69279833
Sequence CCTTTTCTGCAGAAGTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 302}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956440945_956440951 -4 Left 956440945 3:69279811-69279833 CCTTCCCACTTCTGCAGAAAAGG 0: 1
1: 0
2: 5
3: 34
4: 302
Right 956440951 3:69279830-69279852 AAGGGAGCTGAGGCTGTCTGTGG 0: 1
1: 1
2: 2
3: 46
4: 433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956440945 Original CRISPR CCTTTTCTGCAGAAGTGGGA AGG (reversed) Intronic
902679383 1:18032215-18032237 GCTTTGCTGCAAAAGTGGGGAGG + Intergenic
903693695 1:25192480-25192502 CCTGTTCTGGGGCAGTGGGAAGG - Intergenic
903812461 1:26042434-26042456 CCTTTTCCCTAGAACTGGGAGGG + Intronic
904882927 1:33714390-33714412 CCTTATCTGCAAAATAGGGATGG - Intronic
905690846 1:39941497-39941519 CCTTTTCTCCAGAAGTCAGGTGG + Intergenic
905882424 1:41473368-41473390 GCTTTTGGGCAGATGTGGGAGGG + Intergenic
905942741 1:41876994-41877016 TCCTTACTGAAGAAGTGGGAAGG + Intronic
906123418 1:43410983-43411005 CATTTTCTACAGAAGAGGAATGG - Intronic
906380583 1:45329842-45329864 CCTTTTCTTCAGGTTTGGGAGGG - Intronic
908806384 1:67937255-67937277 CCCTTTCAGCAGAAGAGGGAAGG + Intergenic
909237465 1:73171843-73171865 CCCTTTCAGCAGAAGGAGGAAGG - Intergenic
910434442 1:87190953-87190975 GCTTTTCTGCTGGAGAGGGAGGG + Intergenic
911554639 1:99328923-99328945 AGTCTTCTGCAGAAGTGGGAAGG - Intergenic
911872918 1:103121824-103121846 CCTCTTTTGCAGAAATGGAAAGG + Intergenic
911922453 1:103782947-103782969 TCTTTGCTGCAGTGGTGGGAAGG - Intergenic
912932844 1:113980191-113980213 CCTTTTCTGCAGGAGTGGAAGGG + Intronic
916273913 1:162972846-162972868 CCTTTTCAGCAGAAGTTAGAGGG + Intergenic
916563705 1:165955117-165955139 CCTGGGCTCCAGAAGTGGGAGGG - Intergenic
917468063 1:175300929-175300951 ACTTTTCTGCTGATTTGGGATGG - Intergenic
918316280 1:183325130-183325152 CCTGATCTGCTGAAGTGGGAAGG + Intronic
918703039 1:187629567-187629589 CCTTTACTGAAGAATGGGGATGG + Intergenic
919811620 1:201412375-201412397 CCTGGTGGGCAGAAGTGGGAAGG + Intronic
920915313 1:210253787-210253809 GCTTTTCTGCAGAGGGGGCAGGG + Intergenic
921289152 1:213638870-213638892 CCTTTTTTGCAGAAATTGGTAGG - Intergenic
921960777 1:221031615-221031637 TGGTTTTTGCAGAAGTGGGATGG - Intergenic
922990110 1:229900529-229900551 CCTGTTCTCCAGAAATGGGAGGG - Intergenic
923062084 1:230484843-230484865 CCTTTTCTCCAGTACAGGGAGGG - Intergenic
923883360 1:238128431-238128453 ACTTTTCTGCAAAAGCAGGAAGG - Intergenic
923897471 1:238288095-238288117 CCTTGTCTGCAGAAGTTGTAAGG - Intergenic
924633338 1:245762853-245762875 CCTTGTGTGCAGAAGAGTGACGG - Intronic
1067130004 10:43555290-43555312 TCTTCTCTGCAGAAGTTGAATGG - Intergenic
1067554056 10:47255511-47255533 CCTTTACTGCAGAAGAGAGTGGG - Intergenic
1067984059 10:51122222-51122244 CCTTTGCTACACATGTGGGATGG - Intronic
1068704897 10:60064278-60064300 TCTTTTCTACAGAACTGGCAAGG - Exonic
1070626466 10:78054514-78054536 CCTCATCTGCAAAAGCGGGAAGG - Exonic
1071486455 10:86105700-86105722 CCTTTGCTGGAGAGGGGGGATGG - Intronic
1072380461 10:94863744-94863766 CCATTTTTGCAGAAGTGAGGTGG + Intergenic
1072663865 10:97380247-97380269 CCTTTTTTCCAGCAATGGGAGGG + Intronic
1072686443 10:97540040-97540062 CCTTCTCTGAGGAAGGGGGAGGG + Intronic
1074141042 10:110672678-110672700 TCTTTTCTCCTGGAGTGGGAAGG + Intronic
1074360297 10:112820223-112820245 CCTTTTCTGTTGAGGTGTGAAGG - Intergenic
1075062156 10:119264736-119264758 ACTATTCTTCAGCAGTGGGAGGG + Intronic
1075178311 10:120186146-120186168 CCTATTCTGCTGAAGGGGGATGG + Intergenic
1076352945 10:129831316-129831338 CCTATGGTGCAGGAGTGGGAGGG - Intergenic
1077672548 11:4168791-4168813 GCTTTTGTGCATAAGTGTGAAGG - Intergenic
1079294463 11:19219941-19219963 CTTTTCCTGCAGGAGAGGGATGG + Intergenic
1079296541 11:19240480-19240502 CCTTTTCTACAGATGGGAGAGGG - Intronic
1079323171 11:19469418-19469440 CCTTTCCTGCACAACTGGGTGGG + Intronic
1081492836 11:43580801-43580823 CTTTTTTTTCAGAAGGGGGAGGG - Intronic
1081812152 11:45920196-45920218 CCCTCCCTGCAGAACTGGGAAGG + Intergenic
1083069918 11:59967528-59967550 ACCTTTCTGCAGATGTGGGGAGG + Intergenic
1083584015 11:63843415-63843437 CCACTTCTGCTGCAGTGGGAAGG + Intronic
1084686270 11:70697779-70697801 CATCTCCTGCAGAGGTGGGAGGG - Intronic
1087137457 11:94735179-94735201 CCTCTGCTGCAGAGGTGGCAGGG - Intronic
1087236807 11:95728524-95728546 CCTTTTCTGCAGATCTGCTATGG - Intergenic
1087537488 11:99467670-99467692 CTTTTTCTGCAGGATTGGGCAGG + Intronic
1087702156 11:101447340-101447362 CATTTTCTGAAGAAGAGTGAAGG + Intergenic
1088105695 11:106204421-106204443 CCTCTGCTTCAGAAGTGGGTTGG + Intergenic
1088842438 11:113638349-113638371 ACTTTTCTGAATAAGTGGGATGG - Intergenic
1089700613 11:120241788-120241810 CCCATTCTGTGGAAGTGGGAGGG + Intronic
1089889850 11:121870083-121870105 CACTTTCTGCAGAAATGAGAAGG + Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1091413069 12:257019-257041 CCTTTGCTGCTGATGTGGGAAGG - Intronic
1092203196 12:6600002-6600024 CCTTTACTGCAGGAGAAGGAAGG - Exonic
1092528661 12:9326557-9326579 CCTTCTCTTCAGAGGTGGAAAGG + Intergenic
1092561573 12:9619700-9619722 CCTTTCCCGCCTAAGTGGGATGG - Intergenic
1093484406 12:19637932-19637954 CTTTTTCTGCAAAATGGGGATGG + Intronic
1093673564 12:21906186-21906208 CATTTTCTGCAAAAGTGTGGAGG - Exonic
1093805406 12:23426538-23426560 CCTTTTCAGTAGATGTGGTAAGG - Intergenic
1093952640 12:25181289-25181311 CATTTTTTGCAGAGGTGGGGGGG + Intronic
1093970054 12:25368313-25368335 CCTATTCTGCAGAAACTGGAAGG + Intergenic
1094110125 12:26853484-26853506 CCTTTGCCACAGAATTGGGAGGG - Intergenic
1094492693 12:30970840-30970862 TCTTTTCTGCACAAATGGGCCGG + Intronic
1095732493 12:45521187-45521209 CCCTTTCAGCAGAAGAGGGGTGG + Intergenic
1097824090 12:64156886-64156908 CCTTCTCTGAAGAAGTGATAGGG + Exonic
1098075430 12:66724789-66724811 CTTTGTCTGCAGAAGTGGAAGGG + Intronic
1100284720 12:93154418-93154440 CCTTTTCTGGCCAATTGGGATGG - Intergenic
1101434729 12:104654882-104654904 CCTGTTCTGGAGATGGGGGAGGG - Intronic
1102037111 12:109777311-109777333 CCTTCACTGCAGAAGTGGTCTGG + Intergenic
1102652200 12:114449869-114449891 CCTTTTCTCCAGATGGGGGGAGG - Intergenic
1102832631 12:116019233-116019255 CCTGTTCTGGAGAGGTGGGAGGG + Exonic
1103335269 12:120184630-120184652 CCTTGTCTGCAGAATGGGGATGG - Intronic
1103931837 12:124454640-124454662 CCTTTTCTGCCAAATAGGGATGG - Intronic
1105753506 13:23444019-23444041 CCCTTTCAGCAGAAGAGGGATGG - Intergenic
1105830232 13:24157607-24157629 CTTTTTCTGCAGTAGAGGGTGGG + Intronic
1105908733 13:24840181-24840203 CCATTTCTGCAGGAGTGAGGAGG - Intronic
1106406817 13:29481642-29481664 CCTCTTCTGGGGCAGTGGGAGGG - Intronic
1107998820 13:45888157-45888179 CCTCATCTGCAAAAGAGGGATGG - Intergenic
1108025344 13:46171531-46171553 CCTTTTCTCCACCAGTGGCAGGG - Intronic
1108208688 13:48116877-48116899 CCTTTGCTTCTGAAGTGGGTTGG + Intergenic
1108230981 13:48340021-48340043 CATTTTCTACAGAGGTGCGAAGG + Intronic
1108572749 13:51767268-51767290 CCTTTTCTGCAGGAGGATGATGG - Exonic
1108841917 13:54628213-54628235 CCCTTTCAACAGAAGTGAGATGG + Intergenic
1109429095 13:62208727-62208749 CCTTTGCTGCAGAAGTGGTCTGG - Intergenic
1110628472 13:77678439-77678461 TCTTTTCTGCAGCGGTGGGGAGG - Intergenic
1110928766 13:81188519-81188541 CCATTTCTCCAGGAGTGGCAAGG - Intergenic
1112983899 13:105422656-105422678 GCATTTCTGCAGGAGTGAGATGG - Intergenic
1114456829 14:22860614-22860636 CTTTTGCTGCAGAAGTGTGGGGG - Intergenic
1115422190 14:33208432-33208454 CATTTTCTGAAGATGAGGGAAGG + Intronic
1116778781 14:49212762-49212784 CCCTTTCAGCGGAAGAGGGATGG - Intergenic
1117102665 14:52366386-52366408 CCTTTTCTGTAGATGTGGGCTGG + Intergenic
1117642631 14:57816377-57816399 CATTTTCTGCATGACTGGGAGGG - Intronic
1119645999 14:76349006-76349028 GCTTTTCTGGGGGAGTGGGAAGG - Intronic
1119867849 14:77989065-77989087 CCCTTTCTGCAGATCTGGGCTGG + Intergenic
1120514331 14:85452400-85452422 CCTTATCTGCAGAATGGGGGTGG + Intergenic
1120548165 14:85835849-85835871 ATTTTTCTAAAGAAGTGGGATGG + Intergenic
1121349415 14:93161583-93161605 CATTTTCTGTAGAAGGGGGTGGG + Intergenic
1121898378 14:97670250-97670272 ACGTGTCTGCAGAAATGGGAGGG - Intergenic
1122267097 14:100551818-100551840 GCTGCTCTGCAGAAGTGGGCGGG + Intronic
1122664468 14:103319095-103319117 CCTGTTTTTCAGCAGTGGGATGG - Intergenic
1123137049 14:106037817-106037839 CCTGTTCTGCAGAGGTGGGGAGG + Intergenic
1123163303 14:106301311-106301333 CCTGTTCTGCAGAGGTAGGGAGG + Intergenic
1123206991 14:106723489-106723511 CCTGTTCTGCAGAGGTGGGGAGG + Intergenic
1123212010 14:106770492-106770514 CCTGTTCTGCAGAGGTGGGGAGG + Intergenic
1125000157 15:34761229-34761251 TATTTTATGCAGAAGTGGGATGG + Intergenic
1125105089 15:35961559-35961581 CTGTTTCTGCAGCACTGGGATGG - Intergenic
1126231076 15:46325845-46325867 CCTTGTCTGCAGGATTTGGAAGG - Intergenic
1128511506 15:68316448-68316470 CCTTCTCTGCAGGAGTGGCTGGG + Intronic
1128607756 15:69049435-69049457 CCATTTCTGGAGAAGTAGGATGG + Intronic
1128704213 15:69826969-69826991 CCTTCTCTGCAAAATTAGGAAGG - Intergenic
1129792924 15:78353609-78353631 CCCTATCCCCAGAAGTGGGAGGG + Intergenic
1130135381 15:81177487-81177509 CCTTTTATGCAGGGGAGGGATGG + Intronic
1130862346 15:87902262-87902284 CCATTTCTACAAGAGTGGGACGG - Intronic
1130957914 15:88639983-88640005 CCTGTTCTCCAGGACTGGGAGGG - Intronic
1131311838 15:91297308-91297330 CCTTTGCTGCAGAGGAGGCAGGG + Exonic
1131365196 15:91833198-91833220 CCCTTTCAGCAGAAGGGGGATGG - Intergenic
1132592892 16:734053-734075 CCTCTGCTGCAGAAGAGGAAGGG + Intronic
1133379320 16:5316740-5316762 CCCTTTCAGCAGAAGAGAGATGG - Intergenic
1133627132 16:7581244-7581266 TCTGTTCTGCAGGAGTTGGAAGG - Intronic
1133736351 16:8618988-8619010 CCATGTCTGCAGCAGAGGGAAGG - Intergenic
1134654209 16:15935042-15935064 TCTTTTCTGCAGAAGTGGAAAGG + Intergenic
1134778459 16:16873390-16873412 CCTCTCCTGCAGAGGTGGGGCGG - Intergenic
1134881525 16:17748550-17748572 CCCTTTCTGCTGGAGTGGGGAGG - Intergenic
1135106868 16:19657419-19657441 GTTTATCTGCAGAAATGGGAAGG - Intronic
1135185239 16:20309987-20310009 CCTTATCTGTAGCTGTGGGAAGG + Intronic
1135286612 16:21199002-21199024 CCTTTACTGTAGAAGTGGGATGG + Intronic
1136772006 16:32848219-32848241 CCTGTTCTGCAGAGGTAGGGAGG - Intergenic
1136898604 16:34013302-34013324 CCTGTTCTGCAGAGGTAGGGAGG + Intergenic
1136924766 16:34361944-34361966 AGTGTTCTGCAAAAGTGGGATGG - Intergenic
1136979807 16:35049862-35049884 AGTGTTCTGCAAAAGTGGGATGG + Intergenic
1138295907 16:55884979-55885001 CCTTCTCAGCAGTAGTAGGAGGG - Intronic
1139372260 16:66476423-66476445 CCTTGTCTGTAGAATGGGGATGG + Intronic
1140536754 16:75716714-75716736 CCTCCTCTCCAGAAGTTGGAGGG + Intronic
1141082059 16:81061359-81061381 CCGTTTCTGCAGAAGCTGCAAGG + Exonic
1203074427 16_KI270728v1_random:1110308-1110330 CCTGTTCTGCAGAGGTAGGGAGG - Intergenic
1143105189 17:4526271-4526293 CCATTTCTGCATCAGTGGGTTGG - Intronic
1143368417 17:6423175-6423197 CCTTTTCTTCAAGGGTGGGAAGG + Intronic
1146986684 17:37226835-37226857 CCTTCTTTCCAAAAGTGGGAGGG - Intronic
1147334535 17:39719456-39719478 CGTTCTCTGGAGAAGTGGTATGG + Intronic
1147557424 17:41488414-41488436 CCTTTGCTGCAGACTTGGCAGGG - Intronic
1147817964 17:43223930-43223952 CACTCTCTGCAGAAGTTGGAAGG + Intergenic
1148743948 17:49908177-49908199 GCTTTTCTGCTGGGGTGGGAAGG - Intergenic
1149528647 17:57377768-57377790 CCTTCACTTCTGAAGTGGGATGG - Intronic
1151508690 17:74545104-74545126 CCCTCTGTGCAGAGGTGGGAAGG + Intronic
1152277278 17:79365265-79365287 CCACTCCAGCAGAAGTGGGAGGG + Intronic
1152585553 17:81187997-81188019 CCCTGTCTGCAAAAGGGGGAAGG + Intergenic
1153815617 18:8787476-8787498 CCTGATCTGCAGTAGTGGGACGG + Intronic
1158737787 18:60103655-60103677 CAGCTGCTGCAGAAGTGGGAAGG - Intergenic
1159442758 18:68502848-68502870 CCTTGTCTGCAAAATGGGGATGG - Intergenic
1161054525 19:2183510-2183532 GCTTTTCTGGAGAAATGGAAAGG - Intronic
1161338204 19:3725992-3726014 CCTGATCTCCAGGAGTGGGAAGG - Intronic
1161704863 19:5814921-5814943 CGTTTTCTCCAGGACTGGGAAGG + Intergenic
1163488642 19:17604601-17604623 CTTTTTCTGCTGGATTGGGAAGG - Exonic
1163835570 19:19571452-19571474 CCCTCTCTGCAGAGCTGGGACGG - Intronic
1164404144 19:27927548-27927570 ATTTTTGTGCAGAAGTGGAAAGG - Intergenic
1165601148 19:37056668-37056690 CCTTATCTGTTGAGGTGGGAAGG - Intronic
1166258502 19:41621763-41621785 TGTTTTCTGCAGAAAGGGGAAGG + Exonic
1166411135 19:42555918-42555940 TTTTTTCTGCAGAAAGGGGAAGG + Intronic
1166880700 19:45928293-45928315 ACAATTCTGCAGAAGTGGGGTGG + Intergenic
1167006828 19:46781733-46781755 CCTTCTCTGCACAAGTGGCTGGG - Intronic
1168370996 19:55834254-55834276 CCTTTTCTGAAAAAGTGGTTTGG - Intronic
1168430899 19:56279066-56279088 CCCTTTCAGCAGAAGACGGATGG + Intronic
1168686505 19:58352435-58352457 ACTTTTCTGCTGAGGCGGGAGGG - Exonic
925712051 2:6750609-6750631 CCTTATCTGCAGAATAGGCAAGG - Intergenic
927024667 2:19053963-19053985 CCATTCTTGCAGAAGTGAGATGG + Intergenic
928884618 2:36134160-36134182 CCTTTTCTGCAAAAATGAGTTGG + Intergenic
928904107 2:36353479-36353501 CCTCCTCTGCAAGAGTGGGAGGG + Intergenic
930268136 2:49223778-49223800 CTTGTGCTGCAGAATTGGGAAGG - Intergenic
934991781 2:98926808-98926830 CCTTCGCTGCAGGCGTGGGAAGG - Intronic
936093746 2:109516616-109516638 TCATTACTGAAGAAGTGGGAAGG + Intergenic
938182694 2:129197207-129197229 ACTTCTCTGAAGAAGTGGAATGG + Intergenic
942547977 2:177084324-177084346 CCCTCTCTGCAGAAGTGGGCTGG - Intergenic
945056335 2:205872603-205872625 TCTTGTCTGCTGCAGTGGGAGGG + Intergenic
945248759 2:207745279-207745301 AGTGTTCTGCACAAGTGGGAGGG + Intronic
945718016 2:213382419-213382441 CCTTTTCTCCAGAAGTCTGGAGG + Intronic
945801830 2:214442297-214442319 TCTTTTAGGCAGAAGTGAGAAGG + Intronic
947610169 2:231520203-231520225 CTTTTTCTGCTGAAGTTGGCTGG - Intergenic
947760360 2:232599631-232599653 CCAATTCTCCAGAAGTGGGGAGG + Intergenic
947898146 2:233694449-233694471 CCTTTTCAGCAAAAGGGGTATGG + Intronic
948627834 2:239279996-239280018 CCTCTTCCGCAGGAGTGGAAGGG - Intronic
1169377017 20:5074229-5074251 GCTTTTAGGCAGAAATGGGAGGG - Intronic
1170388715 20:15849278-15849300 TCTTTCTTGCAGGAGTGGGAGGG + Intronic
1172008760 20:31834341-31834363 CCTTATCTGCTGGAGTGGGGAGG - Exonic
1172240068 20:33407257-33407279 CCTTTCCTGCAGAAGGGAGGTGG - Intergenic
1172273204 20:33666215-33666237 CTTTTTCTTCAGCACTGGGAGGG + Intronic
1172645686 20:36467886-36467908 CCTTATCTGCAAAACAGGGATGG - Intronic
1173434348 20:43019274-43019296 CCCTTTTAGCAGAAATGGGATGG - Intronic
1174535637 20:51249155-51249177 CCGGTCCTGCAGCAGTGGGAAGG - Intergenic
1174572732 20:51513874-51513896 CTTTTTCTGCACAAGTGAGAAGG + Intronic
1175904149 20:62371580-62371602 CCTTTTCTTCCCAAGTGGCAAGG + Intergenic
1176171749 20:63699355-63699377 CCCTTCCTGCGGATGTGGGAAGG - Exonic
1177576890 21:22969146-22969168 TCTGTTCTGCTGAAGTGGGACGG - Intergenic
1178085235 21:29105556-29105578 ATTTATCTGGAGAAGTGGGATGG + Intronic
1178117519 21:29432617-29432639 TCTTTCCTGCAGAAGAAGGATGG + Intronic
1179111973 21:38455166-38455188 ACTTTTCTTCAGAAGTTTGAGGG - Intronic
1179384998 21:40933461-40933483 CCATTTCAGCAGCAGTGGGGAGG - Intergenic
1179486390 21:41713514-41713536 CAGCTTCTGCAGATGTGGGAAGG + Intergenic
1179924863 21:44528843-44528865 CCTTTTCTGCCTCAATGGGATGG - Intronic
1180059431 21:45376919-45376941 CATGTTCTGCAGCAGAGGGAGGG + Intergenic
1182051503 22:27316006-27316028 CTTTTTCTGAGCAAGTGGGAGGG - Intergenic
1182916687 22:34039681-34039703 CCTCTTCCTCAGAAGTGGTACGG - Intergenic
949805719 3:7953267-7953289 CCCTTTCAGCAGAAAAGGGAAGG + Intergenic
950840312 3:15962145-15962167 CCATTCTTGCAGAAGTGAGACGG + Intergenic
951607069 3:24447436-24447458 CCTTCTTTGCAGTAATGGGAGGG + Intronic
954553759 3:51502828-51502850 TCTTTTTCCCAGAAGTGGGAAGG - Intergenic
955996321 3:64684489-64684511 CCACTGCTGCAGAAGTGGTAAGG + Intronic
956440945 3:69279811-69279833 CCTTTTCTGCAGAAGTGGGAAGG - Intronic
957025497 3:75177260-75177282 CCTTTTCTGTAGAAGTGGGGGGG + Intergenic
957878101 3:86175164-86175186 CTTTTGCTGCAGACGTGGGTAGG + Intergenic
958143885 3:89599282-89599304 CCTTTCCCGCAGATGTGGGGTGG - Intergenic
960200049 3:114822173-114822195 CCTATTCTACAGAAGTTGTATGG + Intronic
961457321 3:127030631-127030653 CAGTTCCTGCAGCAGTGGGAGGG - Intronic
961766871 3:129218298-129218320 CTTTTTCTGCAGAAGGATGAGGG + Intergenic
966759783 3:183407705-183407727 CATATTCTGCAGAAATGAGAAGG - Intronic
966808031 3:183821357-183821379 CCTTGTCTGTAGAATGGGGACGG + Intronic
966951404 3:184821784-184821806 TCTTTTCTGCAGAAGCGAGCTGG + Intronic
968750896 4:2388461-2388483 CTTCTTGTGCAGCAGTGGGATGG - Intronic
969556726 4:7916604-7916626 CCCCTCCTGCAGGAGTGGGAAGG + Intronic
970897585 4:21121233-21121255 CTTTTTCTGCATAAGGGGGCCGG - Intronic
973063394 4:45758235-45758257 CCTTTTCACCAGAAGTGAGATGG - Intergenic
973716844 4:53685276-53685298 CCCTTGCTGGAGAAGAGGGAGGG - Intronic
974633892 4:64533455-64533477 CCCTTTCAGGGGAAGTGGGATGG - Intergenic
975571842 4:75825868-75825890 CCTTTTCTGCAGATATAGGGAGG + Intergenic
975653203 4:76614956-76614978 TTTTTTCTGGAGAAGAGGGAAGG - Intronic
978065624 4:104396388-104396410 CCTTATCTACAGAAGAGAGAGGG - Intergenic
979657066 4:123207904-123207926 CATTTTTTGCGGAAGTGAGAAGG + Intronic
981168921 4:141598450-141598472 CCATTCCTGCAGAAGTGAGGTGG - Intergenic
981883837 4:149649170-149649192 CCTTTTCTGAACAGGTGGGGTGG - Intergenic
982114313 4:152084679-152084701 CTATTCCTGCAGGAGTGGGACGG - Intergenic
983346921 4:166538646-166538668 CCTTATCTTCAGAAAGGGGATGG + Intergenic
985025087 4:185732588-185732610 TCAGTTCTGCAGATGTGGGAAGG + Intronic
985135842 4:186785338-186785360 ACATATCTCCAGAAGTGGGATGG + Intergenic
987276564 5:16369492-16369514 CCTTTTCTCAAGAACAGGGAAGG - Intergenic
988536441 5:32073383-32073405 CCCTTTCTGCAGATGAAGGAAGG + Intronic
991244548 5:64496351-64496373 CCATTTCTGTGGAAGTTGGAAGG - Intergenic
992844312 5:80729895-80729917 CCCATTCTGCACAAGTGGGAGGG + Intronic
993900828 5:93583492-93583514 CCATTCCTGCAGAAGAGAGAGGG + Exonic
995537639 5:113153276-113153298 CCTTTCCCCCAGAAGTAGGAGGG - Intronic
995840705 5:116440755-116440777 TCTCTTGTACAGAAGTGGGAAGG - Intergenic
997255898 5:132427738-132427760 CAATTTCTGCAGGAATGGGAGGG + Intronic
997679360 5:135738451-135738473 CATTTGCTGCAGAAGGTGGAGGG + Intergenic
997837775 5:137210225-137210247 CCTGTTCTATAGAAGAGGGAGGG - Intronic
998059766 5:139110777-139110799 CCCTGTCTTCAGAAGAGGGAAGG + Intronic
998409452 5:141898187-141898209 CCTTTTCTTCAGTATAGGGAGGG - Intergenic
999610745 5:153366655-153366677 CATTTGCAGCTGAAGTGGGAGGG - Intergenic
1000369482 5:160520913-160520935 CCCTTGCAGCAGAAGAGGGAAGG - Intergenic
1001721256 5:173859028-173859050 GCTTTTCTTCTGCAGTGGGAGGG - Intergenic
1001775750 5:174327960-174327982 CCTTATCTGTAAAAATGGGACGG + Intergenic
1001861509 5:175059781-175059803 GCATTTCTGCAGAAGTGCGGTGG - Intergenic
1003543990 6:7042967-7042989 CCTTTTTTGCTTCAGTGGGATGG - Intergenic
1005033153 6:21530163-21530185 CATTTTCTGCAGGAGCTGGAAGG - Intergenic
1005588598 6:27301480-27301502 GCTATTCTGGAGAGGTGGGAGGG - Intronic
1006312860 6:33273239-33273261 CCTTTCCTGTCGAAGTGTGAAGG + Intronic
1007432539 6:41785118-41785140 CCCCTTCTGCAGAAATGAGAGGG - Intronic
1008608849 6:53167236-53167258 TCTTTTCTGCAAAAATGGAATGG + Intergenic
1012097853 6:94987772-94987794 GATTTTTTGCAGGAGTGGGAAGG + Intergenic
1014564512 6:122931213-122931235 GCATTTCTGAAGAATTGGGAGGG + Intergenic
1015404124 6:132818264-132818286 CCTTTTGTGCAGGAGCGAGAGGG + Intergenic
1016594950 6:145788642-145788664 TCCTTTCAGCAGAAGAGGGATGG - Intergenic
1016882950 6:148929067-148929089 CCTTTTCTGTAGATGAGGAATGG + Intronic
1017444943 6:154499141-154499163 TCCTTTCTGCAGAATAGGGAGGG - Intronic
1018122932 6:160655251-160655273 AGTTATCTGCAGAAGTGGCAGGG + Intronic
1018682682 6:166277044-166277066 CCTTTTCAGCAGCACTGGTATGG - Intergenic
1019830081 7:3319262-3319284 CCTTTTCCACAGGAGAGGGATGG + Intronic
1019840129 7:3433422-3433444 TCTTTTCTCCAGAAGAGGTAAGG + Intronic
1020654521 7:10913666-10913688 CCGTCACTGCAGCAGTGGGAAGG - Intergenic
1023535332 7:41202841-41202863 ACTTTTCTCCAGAAGTGAGCAGG + Intergenic
1024524769 7:50338626-50338648 CCTTTTATGCAAAAGTAGAAAGG + Intronic
1028295516 7:89124990-89125012 CCTTTTCTTCAGGAGAGTGACGG - Intronic
1031071431 7:117166558-117166580 CCTTTTAAGCAGGAGTGTGATGG + Intronic
1031201719 7:118696996-118697018 CCCTTTCAGCAGAAGAGGCATGG - Intergenic
1032689123 7:134265117-134265139 TCTTTTCTGGAGAAGTGGGGAGG + Intergenic
1034329537 7:150270414-150270436 CCTTCTCGGCAGAATGGGGATGG - Intronic
1034668519 7:152839447-152839469 CCTTCTCGGCAGAATGGGGATGG + Intronic
1034757132 7:153633068-153633090 CCTTTTCTGCAAGAGTGGAAAGG - Intergenic
1035170057 7:157012080-157012102 CCTTTTGAGGAGAAGTGGCAAGG - Intergenic
1036097549 8:5740878-5740900 CCTCTTCTACTGAAGTGGCATGG + Intergenic
1036402176 8:8418679-8418701 ACTGTTCTGCAGAAGTGTGGTGG - Intergenic
1037299029 8:17432039-17432061 GCTTTTCTACAGAAGTGGGGAGG + Intergenic
1037769713 8:21791191-21791213 CATTTTCTGGATAGGTGGGAGGG - Intronic
1038323485 8:26551126-26551148 CCCTTTGAGCAGAAGAGGGATGG + Intronic
1039381601 8:37090841-37090863 CGTTTTCTAAACAAGTGGGATGG + Intergenic
1039608888 8:38903545-38903567 TTTGTTCTGCAGAAGTGGGAAGG + Intronic
1041573618 8:59367508-59367530 GTTTTTCTGCTGAAGTGAGAGGG + Intergenic
1041606870 8:59792446-59792468 CCTTTCCTCAAGAAGAGGGAAGG - Intergenic
1042824900 8:72970103-72970125 CCTTTTCTGTAGATGGGGTAAGG - Intergenic
1043357545 8:79430958-79430980 CGTGTGCTGCAGAAGTGAGAAGG + Intergenic
1043506167 8:80905255-80905277 CCATTATTGCAGAAGTGGGTTGG + Intergenic
1044524700 8:93239503-93239525 CATTTTCTGCAGGACTGAGAAGG - Intergenic
1045321135 8:101081985-101082007 CCTCTCCTGCAGAAGTGGGTAGG - Intergenic
1046197552 8:110884193-110884215 CGTTATCTGCAGAAGAGGGCAGG - Intergenic
1046668042 8:117026695-117026717 CCTTATCTGCAGAACAGGGGAGG + Intronic
1047026319 8:120828309-120828331 CCTTTTCTTGAGAATTGTGAAGG + Intergenic
1048047990 8:130791340-130791362 CCTTTTCTCCAGGAATGGGGAGG - Intronic
1048680038 8:136831449-136831471 TCTTTTCTGCGGATGTGTGAAGG - Intergenic
1049385015 8:142338801-142338823 CCCTGTCTGCAGCCGTGGGACGG - Intronic
1049753668 8:144297941-144297963 CATTTTCTGCAGCACTGTGAAGG - Intronic
1049811980 8:144579755-144579777 GGCTTTCTGCAGAGGTGGGAAGG - Intronic
1050008476 9:1160005-1160027 CCTTTTCAGGATAAGTTGGAAGG + Intergenic
1050124121 9:2338843-2338865 CAATTTCTGTAGCAGTGGGAAGG - Intergenic
1050400715 9:5250705-5250727 CCATTCTTGCAGAAGTGAGATGG - Intergenic
1050731932 9:8718699-8718721 ACGTTTCTGCAGATGTAGGAAGG - Intronic
1053365497 9:37519721-37519743 CATTTTCTGAATAAGTGGGTTGG + Intronic
1055984042 9:82037392-82037414 CCATTTATGCAGAAGTGGGAAGG - Intergenic
1056159701 9:83876536-83876558 CCTTTTTTGCAGAAATGGAAAGG + Intronic
1057266285 9:93620098-93620120 CTCTTTCTGCAGATGTGGGTGGG + Intronic
1057710510 9:97438139-97438161 CCTATTTTGCAGAACTGGTAGGG - Intronic
1058874970 9:109236197-109236219 CCCTTGCTTCTGAAGTGGGAAGG + Intronic
1059801561 9:117754319-117754341 TCTTTTCTGCTGAAGTGAAAAGG - Intergenic
1061681185 9:132243114-132243136 CCTTTTCTACAGAAGTCCAAGGG + Exonic
1185460983 X:332722-332744 CCTTTGCCGGAGAAGTGGGGGGG - Intergenic
1186668587 X:11745366-11745388 CCTTTTCTGCAGCAGTGTCTGGG + Intergenic
1188864597 X:35299743-35299765 CCTTTTCTCAAGCAGAGGGAAGG - Intergenic
1189030061 X:37441368-37441390 CCTTTTCAGTGGAAGTGGGCAGG - Intronic
1189230828 X:39451183-39451205 GCTGTTGTGGAGAAGTGGGAGGG - Intergenic
1189865556 X:45323574-45323596 CCTTCCCTGCCAAAGTGGGAGGG - Intergenic
1190525844 X:51328849-51328871 CCTTTTTTTCAGAATTAGGAAGG - Intergenic
1190543633 X:51502813-51502835 CCTTTTTTTCAGAATTAGGAAGG + Intergenic
1192991461 X:76462509-76462531 CCATTTTTGCAGGAGTGAGATGG + Intergenic
1192992841 X:76480528-76480550 CCATTCCTGCAGGAGTGAGATGG + Intergenic
1193823674 X:86196049-86196071 CCCTTACTGGAGAAGTGGTATGG - Intronic
1194602244 X:95936400-95936422 CCTTTGTTGCAGAAGTGAGATGG + Intergenic
1195050752 X:101094601-101094623 CATTTTCTTCAGCAGAGGGAGGG - Exonic
1196264040 X:113620334-113620356 CCTTTTCTGAAGAATTAGGTAGG - Intergenic
1196938403 X:120752279-120752301 TCTTTTCTGAAGGAGTGGAATGG + Intergenic
1197306265 X:124845713-124845735 CCTTATCTTAAAAAGTGGGAGGG - Intronic
1197327417 X:125110629-125110651 TTTTTTCTGCAGAAATTGGATGG - Intergenic
1197873664 X:131083071-131083093 CCTGATCTGCAGCAGGGGGAGGG - Intronic
1198458296 X:136838756-136838778 CCCTTTAAGCAGAAGAGGGATGG + Intergenic
1199572845 X:149285629-149285651 CCTTTTCTGCTTAATTGGGTTGG + Intergenic
1199722850 X:150555015-150555037 CCTCATCTGCAAAAGAGGGATGG + Intergenic
1201458072 Y:14193092-14193114 CCTATTCAGCAAAAGTTGGAAGG - Intergenic