ID: 956441620

View in Genome Browser
Species Human (GRCh38)
Location 3:69286348-69286370
Sequence GTATGACATCAATCGCATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956441620 Original CRISPR GTATGACATCAATCGCATAA AGG Intronic
902832253 1:19023519-19023541 GTATGACAACAATAGCATAAAGG + Intergenic
903547787 1:24137428-24137450 AAATGAGATCATTCGCATAAAGG - Intronic
904394649 1:30211212-30211234 GAATGACATCAATAACATAAAGG - Intergenic
905984657 1:42268632-42268654 GTATGACAACAATAGCAAAAAGG + Intronic
906697748 1:47836009-47836031 GTATGACAATAATGGCACAAAGG + Intronic
909412065 1:75365929-75365951 GTGTGATATCAATAGCATACAGG - Intronic
913663079 1:121021716-121021738 GCATGGCACCAATCGCAGAAGGG + Intergenic
914014462 1:143804981-143805003 GCATGGCACCAATCGCAGAAGGG + Intergenic
914402078 1:147330993-147331015 GTATGACAACAATAGCACAAGGG + Intergenic
914653086 1:149713538-149713560 GCATGGCACCAATCGCAGAAGGG + Intergenic
914893213 1:151646965-151646987 GTATGACAACAATAGCACAAAGG - Intronic
916376529 1:164159947-164159969 GTATGACAATAATAGCCTAAAGG - Intergenic
916619504 1:166480992-166481014 GTATGAGATCAACCTCATATAGG + Intergenic
917856274 1:179102704-179102726 GAATGACATCAGTAGCAAAATGG + Exonic
918391728 1:184071473-184071495 ATATGACAATAATAGCATAAAGG + Intronic
919449211 1:197750176-197750198 GTATGACAGCAATAGCACAAAGG + Intronic
920803912 1:209215533-209215555 GTATCACATCAATGGAATGAAGG - Intergenic
920883739 1:209904474-209904496 ATATGACATCAAAAGCAGAAGGG - Intergenic
922408859 1:225348925-225348947 TTGTGACATCAATAACATAAGGG + Intronic
1063012509 10:2038514-2038536 CTATGATTTTAATCGCATAATGG + Intergenic
1063124588 10:3127399-3127421 GAATGACATCAACCGCTTAATGG - Intronic
1065041355 10:21700630-21700652 GTATCACATCAATAGAATAAAGG - Intronic
1066053004 10:31653482-31653504 TTATGACAACAACAGCATAAAGG + Intergenic
1069704265 10:70447872-70447894 GAATGAATTCAATCTCATAAAGG + Intronic
1071033394 10:81212703-81212725 GTTTGACATTCATCACATAATGG + Intergenic
1072515467 10:96177540-96177562 GTATGACAACAGTAGCACAAAGG + Intronic
1072908254 10:99475565-99475587 GTATGACACCAATCACACAAAGG + Intergenic
1083190737 11:61050228-61050250 TTATGATATCAATGGCATATGGG + Intergenic
1087403312 11:97695990-97696012 GAATGACATCAATGTCAAAAGGG - Intergenic
1087469639 11:98555814-98555836 GTATGACAATAATAGCACAAAGG - Intergenic
1087834368 11:102857445-102857467 GTATGACAACAATAGCACAAAGG - Intergenic
1088336659 11:108712594-108712616 GAATGACATCAATGATATAAGGG - Intronic
1089385418 11:118064327-118064349 GTATGAAATCAATGGCAGATTGG - Intergenic
1091647023 12:2281228-2281250 GTATGGCAGCAACGGCATAAAGG - Intronic
1093053056 12:14525818-14525840 ATATGACAACAATAGCACAAAGG + Intronic
1093763927 12:22940856-22940878 ATCTGACATCAATTACATAATGG - Intergenic
1096733956 12:53637786-53637808 GTATGACAATAACTGCATAAAGG - Intronic
1096874521 12:54616893-54616915 GTCTGACAGCAATCAGATAAGGG - Intergenic
1097002634 12:55890574-55890596 GTATGACAACAATAGCAAAAAGG + Intergenic
1097846221 12:64369615-64369637 GTATGACAGTAATAGCACAAAGG + Intronic
1098988441 12:77037494-77037516 GTTTGACAACAATGGCACAAAGG + Intronic
1099208135 12:79751752-79751774 GTATGATAGCAATAGCACAAGGG + Intergenic
1099227698 12:79989568-79989590 CTATGACATCCCTCACATAATGG - Intergenic
1102851541 12:116250904-116250926 GTATGACAACAATAGCACAAAGG + Intronic
1102945263 12:116981552-116981574 GTATGACAGTAATAGCACAAAGG + Intronic
1105480079 13:20766897-20766919 GTATGACAACAATAACACAAAGG - Intronic
1105933652 13:25077070-25077092 GTATGACAACAGTAGCACAAAGG + Intergenic
1106265769 13:28108303-28108325 GTGTGCCACCAATTGCATAATGG - Intergenic
1109112419 13:58338449-58338471 ATATGATATCAATAGAATAAAGG - Intergenic
1113393497 13:109920620-109920642 GTATGACATCTATGGCATTGAGG - Intergenic
1114061397 14:19019861-19019883 GCATGACATAAATAGTATAAAGG - Intergenic
1115686232 14:35799148-35799170 ATATGACAACAAAAGCATAAAGG + Intronic
1116746305 14:48823856-48823878 GTATGAGATGAATCTCATTATGG - Intergenic
1118825429 14:69376021-69376043 GTATGACAACAATAGTGTAAAGG - Intergenic
1119413030 14:74447847-74447869 GTATGACAACAATAGCATAAAGG + Intergenic
1119966968 14:78927684-78927706 CTATGAAATCAATATCATAATGG - Intronic
1120057357 14:79940185-79940207 GAATGACAACAATGGCAAAAGGG - Intergenic
1120918639 14:89733368-89733390 GTATGCCAACAATTGCATAAAGG - Intergenic
1121167482 14:91819741-91819763 GTATTACATCAATAGCACAAAGG + Intronic
1122415118 14:101545726-101545748 GGATGACATCACACACATAAGGG - Intergenic
1122432138 14:101659076-101659098 GTATGACAACAATAGCACAAAGG - Intergenic
1123495813 15:20825091-20825113 GCATGACATAAATAGTATAAAGG + Intergenic
1123552299 15:21394183-21394205 GCATGACATAAATAGTATAAAGG + Intergenic
1123588543 15:21831580-21831602 GCATGACATAAATAGTATAAAGG + Intergenic
1124550128 15:30673132-30673154 ATATGACAGCAATTGTATAAAGG + Intronic
1125091325 15:35796146-35796168 GTATGACAACAATGGCATAAGGG - Intergenic
1127421946 15:58814980-58815002 GTAGGACACCAAAAGCATAAGGG - Intronic
1128041634 15:64579757-64579779 GTATGACAATAATAGCACAAAGG - Intronic
1128540864 15:68531139-68531161 GTATGACAATAATAGCATAAAGG - Intergenic
1131467266 15:92665843-92665865 GCATGACATCAAGGGGATAAGGG - Intronic
1131901655 15:97094492-97094514 GTATGACAAGAATAGCATGAGGG - Intergenic
1202960647 15_KI270727v1_random:121416-121438 GCATGACATAAATAGTATAAAGG + Intergenic
1135383564 16:22014530-22014552 GCTTGACATCTATCTCATAAGGG + Intronic
1135462620 16:22658430-22658452 GTATAACAACAATGGCACAAGGG - Intergenic
1140110955 16:72004481-72004503 GTATACCTTCAATTGCATAAGGG - Intergenic
1147151207 17:38515370-38515392 GTATGACAATAATGGCATGAAGG + Intergenic
1149586790 17:57794220-57794242 GTATGACAACTATAGCACAAAGG + Intergenic
1150029452 17:61716976-61716998 GTATGGCAGCAATAGCATAAAGG - Intronic
1152188486 17:78873818-78873840 GTATGAGATCAAGCAGATAAAGG - Exonic
1152939295 17:83159079-83159101 GTATGACAATAATAGCAAAAAGG - Intergenic
1154453215 18:14497541-14497563 GCATGACATAAATAGTATAAAGG + Intergenic
1154512091 18:15116853-15116875 TTATGACTTCAATCTAATAAAGG + Intergenic
1156612638 18:38744034-38744056 GTTTGACAACAATAGCACAAAGG + Intergenic
1159000460 18:62970250-62970272 ATATGACAACAACAGCATAAAGG - Intronic
1164993600 19:32702925-32702947 GTATGACAACAATAGCATAAAGG - Intronic
1165181133 19:33971567-33971589 GTATGACAACAACATCATAAAGG - Intergenic
927648322 2:24894547-24894569 GTATGACAAAAATAGCACAAAGG - Intronic
929350555 2:40947810-40947832 GTATGACAACAATGGCACACAGG - Intergenic
931029171 2:58152389-58152411 GTATAACAACAATAGCACAAAGG - Intronic
931227393 2:60343460-60343482 ATATGAAAACAATAGCATAAAGG + Intergenic
933161685 2:79031204-79031226 GAATGACAGCAATGTCATAAGGG + Intergenic
935284078 2:101548227-101548249 GTATGACATCGATAGCACAAAGG - Intergenic
936764312 2:115827485-115827507 GTATGACAACTGTGGCATAAAGG - Intronic
937842921 2:126543691-126543713 GTATGACAAAAATAGCATAAAGG + Intergenic
938478764 2:131640194-131640216 GCATGACATAAATAGTATAAAGG - Intergenic
941821431 2:169847491-169847513 GTTTGACAACAATAGGATAAAGG - Intronic
942160138 2:173176394-173176416 ATATCACAACAATAGCATAAAGG + Intronic
943352204 2:186808684-186808706 GTATCACATCAGCCACATAAGGG - Intergenic
944076206 2:195733993-195734015 GAATGAAAGCAATGGCATAAGGG + Intronic
947401815 2:229738592-229738614 GTATGACAATAATAGCATATAGG + Intergenic
948911334 2:241004654-241004676 ATATGACAACAATAGCATGAGGG - Intronic
1170753639 20:19176236-19176258 GAATGACAGCAATGTCATAAGGG + Intergenic
1171031151 20:21677417-21677439 TAATAACATTAATCGCATAAGGG - Intergenic
1171129512 20:22637790-22637812 GTATGACAGTAATAGCATAAAGG - Intergenic
1173888954 20:46488468-46488490 GTATGACAGCAACGCCATAAAGG - Intergenic
1176442814 21:6790737-6790759 GCATGACATAAATAGTATAAAGG - Intergenic
1176820969 21:13655738-13655760 GCATGACATAAATAGTATAAAGG - Intergenic
1177720690 21:24903037-24903059 ATATAACATGAACCGCATAATGG + Intergenic
1179406479 21:41130572-41130594 GTATGCCATAAATAGCAGAAGGG + Intergenic
1180479885 22:15742459-15742481 GCATGACATAAATAGTATAAAGG - Intergenic
1180849700 22:19009976-19009998 GTAAGACATCAATAGCTTATGGG + Intergenic
1184284107 22:43457811-43457833 GTATGACAATAATAGCATAAAGG - Intronic
950144402 3:10638332-10638354 GTATGACAATAACAGCATAAAGG + Intronic
950331162 3:12157384-12157406 GTATGAAATCAAACAGATAAAGG - Exonic
952507997 3:34024968-34024990 GTATGACCTCACTTGCATACTGG + Intergenic
953222196 3:40982481-40982503 GTACGACAACATTAGCATAAAGG - Intergenic
953442580 3:42931211-42931233 GTATGAGCTCAATGGCAGAATGG - Intronic
955265737 3:57442364-57442386 ATATGACAACAATAGCACAATGG + Intronic
956441620 3:69286348-69286370 GTATGACATCAATCGCATAAAGG + Intronic
957581061 3:82074026-82074048 ATATTACATCAATCACATAGAGG + Intergenic
959656505 3:108811504-108811526 GTATGACATTAATAACACAAAGG - Intergenic
966275552 3:178161734-178161756 GAATGACAGCAATCACATAAGGG + Intergenic
968849841 4:3071742-3071764 GTAAGACATCAGTCGGATTATGG - Intergenic
978858495 4:113420650-113420672 GTATAACAGCAATAGCACAAAGG + Intergenic
979640329 4:123005828-123005850 ATATGACAACAATAGCACAAAGG - Intronic
979749282 4:124256884-124256906 TTATGACAACATTAGCATAAAGG + Intergenic
984132156 4:175891065-175891087 CTATGTCATCAGTCTCATAAAGG - Intronic
984183274 4:176511450-176511472 ATATGGCAACAATGGCATAATGG - Intergenic
985001546 4:185489230-185489252 GTATAACAATAATAGCATAAAGG - Intergenic
985332392 4:188852502-188852524 ATATCACATCAATAGAATAAAGG + Intergenic
985710705 5:1427241-1427263 CTATGACAACAATTGCACAAAGG + Intronic
987002874 5:13678552-13678574 GTATGACAAAAATAGCACAAAGG + Intergenic
987052865 5:14162775-14162797 ATATGTCATCAACCACATAAAGG + Intronic
989185280 5:38618729-38618751 GTATGACAACAATAGCACGAAGG - Intergenic
991626537 5:68607739-68607761 GTATGACAAATATAGCATAAAGG + Intergenic
993970241 5:94411050-94411072 GTATGACAACAATAGAATAAAGG + Intronic
996390639 5:122957052-122957074 GTATGACACCAAAGGCATGAAGG - Intronic
996655591 5:125930861-125930883 GTATGACATCAGTAGAATAAGGG + Intergenic
999014037 5:148077657-148077679 ATATGACAACAATAGCATAAAGG + Intronic
999340818 5:150770010-150770032 ATATCACATCAATAGAATAAAGG - Intergenic
1000543886 5:162575228-162575250 GAATGACAACAATAACATAAAGG + Intergenic
1003001610 6:2340499-2340521 TTATTACATCAATAGAATAAAGG + Intergenic
1003215930 6:4111949-4111971 TTGTGACATCAATAACATAAGGG - Intronic
1006106026 6:31717335-31717357 GCATGACCTCAATCTCATCATGG - Intronic
1006476199 6:34255962-34255984 GTATTACTTTAATAGCATAAAGG + Intergenic
1010073871 6:71777679-71777701 ATATGACAACAATATCATAAAGG - Intergenic
1013472861 6:110480264-110480286 GAATTACATCCATCTCATAAAGG + Intergenic
1015028364 6:128564744-128564766 GCATGTCATCAATTGCATAAAGG + Intergenic
1016132436 6:140492480-140492502 GTATGACAATAACAGCATAAAGG - Intergenic
1017691868 6:156974848-156974870 GTATGACAACAACAGCAAAAAGG - Intronic
1018539992 6:164869159-164869181 GTATGACAAAAACAGCATAAAGG - Intergenic
1018663215 6:166108037-166108059 CTATGACATCTATAGCATACAGG - Intergenic
1026887624 7:73962711-73962733 GCATGACTACAATAGCATAAAGG - Intergenic
1027566514 7:79801448-79801470 TTATGACATTAATCCAATAAGGG + Intergenic
1028412143 7:90541462-90541484 GCATGACAGCTATAGCATAAAGG - Intronic
1028522316 7:91745803-91745825 ATATGACAACAGTAGCATAAAGG - Intronic
1030157820 7:106474131-106474153 GTATGATAACAGTTGCATAATGG + Intergenic
1030669633 7:112321384-112321406 GTATGACAACAATAGCACAAAGG - Intronic
1031233223 7:119137141-119137163 GTAAGACATTAATAGAATAAAGG + Intergenic
1032907950 7:136394490-136394512 GTGTGACAACAATAGCACAAAGG + Intergenic
1033839679 7:145359290-145359312 GTATGATAATAATGGCATAATGG + Intergenic
1037004128 8:13755947-13755969 GTATGACAGCAACAGCAAAAAGG - Intergenic
1041339442 8:56826999-56827021 GAATGACATCAATGACATAAGGG + Intergenic
1041589268 8:59558086-59558108 ATATGACAACAATAGCACAAAGG - Intergenic
1042454260 8:68982229-68982251 GTAATACATCAATAGAATAAGGG + Intergenic
1043329284 8:79093753-79093775 GTATGACAACCATAACATAAAGG + Intergenic
1045715590 8:105039955-105039977 GTATGACAACAACGGCACAAAGG + Intronic
1047890932 8:129308672-129308694 GTATGACAACAATAGCACAAAGG - Intergenic
1048649152 8:136454870-136454892 GCATTACACCAATCGTATAATGG + Intergenic
1049033566 8:140056469-140056491 ATATGAGATCAATGGAATAAAGG + Intronic
1052155064 9:25177168-25177190 GTATGACAACTATAGCACAAAGG + Intergenic
1053522699 9:38797053-38797075 ATATGACATTAATAGGATAAAGG - Intergenic
1053616144 9:39768491-39768513 GTATTACAACAATGGCACAAGGG + Intergenic
1053874315 9:42527792-42527814 GTATTACAACAATGGCACAAGGG + Intergenic
1053898300 9:42766796-42766818 GTATTACAACAATGGCACAAGGG - Intergenic
1054194924 9:62021473-62021495 ATATGACATTAATAGGATAAAGG - Intergenic
1054237373 9:62573899-62573921 GTATTACAACAATGGCACAAGGG - Intergenic
1054268020 9:62938962-62938984 GTATTACAACAATGGCACAAGGG - Intergenic
1054551508 9:66608410-66608432 GTATTACAACAATGGCACAAGGG - Intergenic
1054643484 9:67567217-67567239 ATATGACATTAATAGGATAAAGG + Intergenic
1055424209 9:76176953-76176975 ATATGACATGTAACGCATAATGG + Intronic
1058862925 9:109134989-109135011 AAATGACATCAAGTGCATAATGG - Exonic
1060774407 9:126361357-126361379 GTATGCCAACAATAGCACAAGGG - Intronic
1061827362 9:133267948-133267970 ATATGACAATAATAGCATAAAGG + Intronic
1203526390 Un_GL000213v1:93796-93818 GCATGACATAAATAGTATAAAGG + Intergenic
1189502191 X:41572617-41572639 GTATGACAACAGTAGCACAAAGG - Intronic
1189879490 X:45474803-45474825 GTATGAAAACAATAGCACAATGG - Intergenic
1191172747 X:57465881-57465903 ATATGACAGCAATAGCACAAAGG + Intronic
1191693938 X:63968856-63968878 GAATGACATCAATGTTATAAGGG + Intergenic
1192110710 X:68360906-68360928 GAATGACAACAATATCATAAGGG + Intronic
1192752874 X:74012584-74012606 GTGTGACATCAAGAACATAATGG + Intergenic
1192849931 X:74943698-74943720 ATATGACATCAATAGCACAAGGG - Intergenic
1196014707 X:110925733-110925755 GTATGACAATAATAGCATAAAGG + Intergenic
1196072110 X:111536876-111536898 ACATGACAACAATAGCATAAAGG + Intergenic
1196602315 X:117616606-117616628 GGATGAGATGAATCTCATAATGG - Intergenic
1198738121 X:139810080-139810102 GTATGACAACAATAACACAAAGG + Intronic
1199663277 X:150074770-150074792 GTATGACAACAATAACATAAAGG + Intergenic
1199739933 X:150725662-150725684 GGATGACAACAACAGCATAAAGG - Intronic
1200046150 X:153402488-153402510 ATATGACAACTATAGCATAAAGG - Intergenic
1200313362 X:155103152-155103174 GTATGACCACAATGGCACAAAGG - Intronic
1200313981 X:155111712-155111734 ATATGACATCAAATGCACAAGGG + Intronic
1200330791 X:155295236-155295258 ATATGACATCCATAGAATAAAGG + Intronic
1200388941 X:155923105-155923127 ATATGTCAACAATAGCATAAAGG - Intronic
1201378386 Y:13345920-13345942 GTATTCCCTCACTCGCATAAAGG + Intronic
1201896881 Y:19001091-19001113 GTATTCCCTCACTCGCATAAAGG + Intergenic