ID: 956442196

View in Genome Browser
Species Human (GRCh38)
Location 3:69291464-69291486
Sequence TCACATATGCAAAAGTCGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956442195_956442196 -10 Left 956442195 3:69291451-69291473 CCTATGGCAACAGTCACATATGC 0: 1
1: 0
2: 0
3: 11
4: 101
Right 956442196 3:69291464-69291486 TCACATATGCAAAAGTCGTAAGG 0: 1
1: 0
2: 0
3: 7
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956442196 Original CRISPR TCACATATGCAAAAGTCGTA AGG Intronic
901362070 1:8710166-8710188 CCACATATGCAAATGCCCTATGG + Intronic
904801359 1:33094977-33094999 ACACATTTACATAAGTCGTAAGG + Intronic
911413861 1:97545993-97546015 TCACATATGGAAAACTCCCAAGG - Intronic
912376088 1:109210963-109210985 TCACATATTCAAAGGTGGCAGGG + Intergenic
916600610 1:166289861-166289883 TGATATATGCAAAAGTCATATGG - Intergenic
922895638 1:229097846-229097868 ACACGTATGCAAAAGTTGTTCGG - Intergenic
924276928 1:242398303-242398325 TCACATATACCAAACTCGTAAGG + Intronic
1063750134 10:8934641-8934663 AGACATATGCAAATGTAGTATGG - Intergenic
1063800759 10:9574634-9574656 CCCCATACGCAAAAGTGGTAAGG + Intergenic
1065615453 10:27516879-27516901 GCAAAAATGCAAAAGTGGTATGG + Intronic
1067355626 10:45522826-45522848 TTCCCTATGCAAAAGTGGTATGG + Intronic
1072061916 10:91821425-91821447 TCATATATTCAAAAATAGTAAGG + Intronic
1078028051 11:7718323-7718345 TTCCATATGCAAAATTCATATGG + Intergenic
1078677579 11:13437308-13437330 TCACATATGAAAAAGACCTGAGG - Intronic
1081680382 11:44998509-44998531 CCACATGTGCAAAAGCCCTAGGG + Intergenic
1086266791 11:85009015-85009037 TGACAAATACAAAAGTCCTAAGG + Intronic
1091261866 11:134241139-134241161 TCAAATATCCAAAAGTAGAAAGG + Intronic
1096944605 12:55390872-55390894 TCACAGATGCAAATATCATATGG - Intergenic
1099717221 12:86311042-86311064 TCACATATAGAAAAGTCATCTGG - Intronic
1100717077 12:97317275-97317297 TTACAGATGAAAAAGTTGTAGGG - Intergenic
1101063924 12:100999742-100999764 TGACATATGTAAAAGACTTAGGG + Intronic
1102414777 12:112751086-112751108 TCAAATAACCAAAAGTCCTAAGG - Intronic
1115701212 14:35954916-35954938 TCACATATGTTAAAGTCTTATGG - Intergenic
1126484757 15:49168014-49168036 TCACATATTCAGAAGTAGTATGG + Intronic
1128034893 15:64516112-64516134 TCAAATATGAAAAAGTCATTGGG - Intronic
1131795273 15:96009956-96009978 TCATATATGCAAAATTCTTGGGG - Intergenic
1137937598 16:52649470-52649492 TCAAATATGCAAAATTAGAAAGG + Intergenic
1140916085 16:79494583-79494605 TCACATCTGCAAAGTTCCTAGGG + Intergenic
1143566990 17:7728362-7728384 GCACATATACAAAAGTGGAAAGG + Intronic
1143957738 17:10686283-10686305 TCAAATATTCAAAATTCCTAAGG + Intronic
1144464157 17:15483281-15483303 TCACATATACACAAGTCCTGGGG - Intronic
1150980505 17:70136520-70136542 TCACTTATGAAAAAGACGTCTGG - Intergenic
1156133162 18:34003429-34003451 TTAGATTTGCAAAAGTGGTAGGG - Intronic
1156330735 18:36119288-36119310 TAACATTTGCAAAACTCCTATGG + Intronic
1156831466 18:41497204-41497226 TCATATCTGCAAAAATTGTAAGG + Intergenic
1164597697 19:29540994-29541016 TCACATGTGCAAAGGTCCTGCGG + Intronic
1168670668 19:58238804-58238826 TCACATATTCACAGGTTGTAGGG + Intronic
930159247 2:48137414-48137436 TCACATATGTGAAAGTTGTGGGG - Intergenic
931014206 2:57956886-57956908 TCAAATATGCAAATGTAGTTTGG + Intronic
936559179 2:113521720-113521742 TCACATCTGCGAAAGGAGTAAGG + Intergenic
944559627 2:200923064-200923086 TCACATATGCAGTAGTTTTAGGG + Intronic
944944574 2:204668750-204668772 TCACATATACAAATGTTCTAGGG - Intronic
946726871 2:222670331-222670353 GCACATATGCAAAGGTCCTGTGG - Intergenic
1169844477 20:9974763-9974785 TTACATATGCAGAAGTTTTAGGG + Intergenic
1170366972 20:15608673-15608695 TCAATTATGCAAAAGGCTTAAGG - Intronic
1170784367 20:19454661-19454683 TCACATTTGCAAAAGACCCAAGG + Intronic
1175938636 20:62526832-62526854 TCACCTAAGCAAAAGTGGAAAGG - Intergenic
1176785187 21:13247871-13247893 TCACTTATGCATAATTCATAAGG - Intergenic
1176919667 21:14672737-14672759 TCACAAATGCAAAAGTCTTTGGG - Intergenic
1177917373 21:27106344-27106366 TCAGATAAGCAACAGTCCTAAGG + Intergenic
1177983225 21:27941625-27941647 TCACTTATGCATAATTCATAAGG - Intergenic
1182069769 22:27455312-27455334 TCAGATATGCAAAAGACTTGGGG - Intergenic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
953708702 3:45251290-45251312 TCACATGTGCAAAAATCTTATGG - Intergenic
955251237 3:57284661-57284683 TCACATATGTAAAAACCGTGAGG - Intronic
955265191 3:57436292-57436314 TCACATATACAAAATGCTTATGG + Intronic
956442196 3:69291464-69291486 TCACATATGCAAAAGTCGTAAGG + Intronic
959225071 3:103570104-103570126 TCACATTTACAAATGTCATATGG + Intergenic
959883330 3:111472074-111472096 TCACATAAGCAAAATGCCTAGGG - Intronic
960450624 3:117802621-117802643 TGACATATGCAAATGTCTTTAGG - Intergenic
966180362 3:177182461-177182483 TCACATATACAAAACTGGAAAGG - Intronic
966216580 3:177509017-177509039 TCAGATATATAAAAGTCGAAGGG + Intergenic
968535456 4:1124992-1125014 GGACATATGCAAAAGTCCTGAGG + Intergenic
968874729 4:3260103-3260125 TCACATAAGCAAAAGTTCTTTGG - Intronic
970271090 4:14348439-14348461 TCACATAAGCAAAAATGGAATGG + Intergenic
972998307 4:44911686-44911708 ACACATATGATAAAGTTGTATGG + Intergenic
973284948 4:48404232-48404254 TTAGAAATGCAAAAGTCGGAGGG - Intronic
974378996 4:61113467-61113489 TAATATATGCAAAATTCCTATGG + Intergenic
974712656 4:65620857-65620879 TCACATATGGAAAAAGCATATGG - Intronic
979931543 4:126638302-126638324 TCTCATATGCAAAACTTTTATGG + Intergenic
980803117 4:137778775-137778797 TGGCATATGCTAAAGTTGTATGG + Intergenic
981936688 4:150247004-150247026 CAACATATGAAAAAGTCATAAGG - Intronic
983855259 4:172635521-172635543 TCAAATATGCAAAATTTGAAAGG - Intronic
988149216 5:27354192-27354214 TCCCACATGAAAAAGTCCTAAGG + Intergenic
988964085 5:36398729-36398751 TGAAATATTCAAAAGTCATAAGG - Intergenic
991629107 5:68636207-68636229 TCAAATATCCAAAAGTGCTAGGG + Intergenic
994043883 5:95286098-95286120 TCTAATATGCAAAAGTCCCATGG + Intergenic
994168771 5:96636793-96636815 ACACTTCTGCAAATGTCGTAAGG - Intronic
1008322308 6:50131558-50131580 TCATCTATACAAAAGTCATAAGG + Intergenic
1009191795 6:60638343-60638365 TCACATTTGGAAAAATCGCAAGG + Intergenic
1011878000 6:91986011-91986033 TCAAATATGCAAAGATCTTATGG - Intergenic
1013201527 6:107901391-107901413 TCACATATGGAAAACTCCCAAGG + Exonic
1015125952 6:129754864-129754886 ACACATATGCAACAGTTGGAAGG + Intergenic
1018865005 6:167739494-167739516 CCACATAAGGAAAAGTCGTCTGG + Intergenic
1019063173 6:169272498-169272520 TCAGACATGCAAAAGTGGAAAGG + Intergenic
1020337967 7:7078091-7078113 TCACATTTGGAGAATTCGTATGG - Intergenic
1022039605 7:26567474-26567496 TCACATTTCCAAAAGTGGGATGG + Intergenic
1022208229 7:28182905-28182927 TCACATATGAAGAAGTAGTAGGG - Intergenic
1030975731 7:116120600-116120622 TTAGATATGCATAAGTCCTATGG - Intronic
1031013983 7:116552524-116552546 TCACATAAGCAAAAGTCTAGGGG + Intronic
1033193653 7:139307917-139307939 TCACATATCCAAAATTCATCAGG - Exonic
1038711758 8:29953425-29953447 TCACATATGCATAAGCTGGAAGG - Intergenic
1039819437 8:41123050-41123072 TAACATATGTAAAAGCTGTAAGG - Intergenic
1041771148 8:61473769-61473791 TTACATATGCAAAAGACCTCTGG - Intronic
1048634601 8:136282431-136282453 TCACTTCTGCTAAAGTCATATGG + Intergenic
1048746767 8:137623273-137623295 ACATTTGTGCAAAAGTCGTATGG + Intergenic
1049129471 8:140825050-140825072 TCCCAGATGCAAAGGTTGTAAGG + Intronic
1049893675 9:94475-94497 TCACATCTGCGAAAGGAGTAAGG - Intergenic
1051180047 9:14401893-14401915 TCATATAAGCAAAAGGTGTAGGG - Intergenic
1053734896 9:41094545-41094567 TCACATCTGCGAAAGGAGTAAGG - Intergenic
1054693486 9:68336852-68336874 TCACATCTGCGAAAGGAGTAAGG + Intronic
1055179670 9:73369373-73369395 TCACAGATGCAAAAGTAAGATGG - Intergenic
1058369206 9:104245700-104245722 TCAGATATGCAAAGATCCTATGG + Intergenic
1058792282 9:108461130-108461152 TCATAGATGCAAAAGTCCTCAGG + Intergenic
1061901538 9:133674851-133674873 TCACAAAAGCAAAAGTCAGATGG + Intronic
1186759391 X:12707914-12707936 TCACATATTCTAAAGTCAGAAGG - Intronic
1188205808 X:27356256-27356278 TCACATTTGCAAAATTTGAATGG + Intergenic
1191724222 X:64261796-64261818 TCACACATGCAAAAGACTGAAGG + Intergenic
1192017226 X:67344329-67344351 GCACATATGAAAAAGACTTATGG - Intergenic
1193646538 X:84076386-84076408 ACACAGATGCAAAAATTGTAAGG + Intronic
1197077343 X:122367934-122367956 TAACATATTCAAAAGTCTGAAGG + Intergenic